GenePrediction:GLEAN_6774 Details

Name: GLEAN_6774
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:121403..120264 (- strand)
Length: 1140
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:121403..121362 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_156:121205..120264 (- strand)
Length: 942
>GLEAN_6774 class=GenePrediction position=GCSC_156:121403..120264 (- strand)
ATGTTCGCTTACCAAGAACCCGCCTCTCGGTATCCTCGAGGGGTGCTTAAGCGTTACCACGAGGAAGAGACAACTATCGA
GTTTTTGAACGGGACGGCCATTGGGTTCAACGAACACAGAAATGCATGTATCCGTCCTTGTTTGGCGCTGTTGTTGATGC
GAAGCTGCTTGCTAACTCTTTGCGTTTGACTCTATTAGAAACGGGTGCACACTCTTCCTCTCAGGACATCTCCATCAGCA
GCTCGGAAATGGGCGCTTCAATCGGAGGCAGCCCCAGTCGAGTCCATCGCCATCACTCCGCCCGGCTCTTCTGTTGATGA
CATGTCAAGCGTCCGAGTTCAGCAACAGCATGACCCGAACGATGTTCTCCTGATGGGCGGTTGTGACATGGATATGGACA
TGGCCATGGACGATTCGGACAACCTGTCAGCACAGCAGATGCCAAATCAAGGCTGCGACCCTGAGCACCACCTGGCTCCT
GGACCACTGCAGCCGGACGACATACAATCGACAATTGCCGGACGCATACCGACGCCCCTGCATCCAAGCTTTGCTGTCCA
GGTCCGGGGTGGTAGCTGGGGCCAAGCCGGCGCGTCCTCAGCATTACGCCACCCTGTACTTGAAGACGGCGACATGCTTT
CTGCAAGCCACGACCTTTCTGTGCCCCGGTCGCTTGACCATGCGTCCATGGGAGACTGGAGCATTGTGCAGAACCGCTCT
CTTCCCTCGCCTATTAGTGAGATCGGGGGCGAGGAGAGTCTAAACTCAGACATGGCTCTCGATCAAATGTCTTACCACAG
CGGCGGCTATGGCGATGGTGCTCTGCCGATGTCGGCCCATTCACCCTGTTACCATGGATCTGACTCACACCACTCACCCA
TGCCGACGCCGACGCGGCCTTCGGCCTCGCCCATGGATGCGCTCTCGTTCCCGGCGTACGGAAGCGATGTGGCGTCTGTG
GACGGCGACCCGGCCTCGCAATCCTCGCCTAGAAAAGGACATACTCGCAGCCGCCACACCGTTGTCGCATGGACACAGCA
GCCCAGCATGAAGAAGTCGTTCAGCATAGGGTACCGCTCTGATTGCGAGAAGTGCCGCAACCGAGTTCCGGGCCACTTCA
ACCATATTATCGTGTCCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62