GenePrediction:GLEAN_6776 Details

Name: GLEAN_6776
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:114559..113468 (- strand)
Length: 1092
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:114559..114557 (- strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_156:114480..114447 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_156:114320..114274 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_156:114081..113923 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_156:113842..113468 (- strand)
Length: 375
>GLEAN_6776 class=GenePrediction position=GCSC_156:114559..113468 (- strand)
ATGGTGTGTATCTGCCTCACTACGAATGAGACTTGCTTTCCAGAACTGCTGGCTAACCGGACCTCTTCTCTCCCTCCAGG
CGATCAAGCACAACAACCAAATCCCTAACAACCGTTAGTCGAACCTGTTCTGTCGATGCACCCATTTCGTTTTCGCTCTT
CCCACGATCGGACGGGGGACATCGATCAACGCTGCTTCTTTTTAGGCAATGGAACCCGATGACTGACTGGATATCACAGA
TTTCCGCAAGGATTGGCAACGCCGCGTCCGGGTGCACTTTGACCAGGTACGATTTTGAACGAGGAGACCGATGAGGGAAA
CGACGCGCCGAAAGTGAGAAGCAAGAAAAGTTTTTGCTGGAGGTCACGCTCGTACCGGGGACGCGTGACCTTTGCATCGC
CGGACCAGGGATGGATTGACAGGGAGACAACGTCTCTCAGGTCGGAGAACCGCAGTTCTAACATATTTTTCACAACAGGC
CGGCAAGAAGCACAGCCGCCGTCTGGCGCGCCAGAGCAAGGCTGCTGCCATCGCCCCGCGGCCCGTCGACCGCCTGCGGC
CCATTGTCCGCTGCCCGACCATCAAGTACAACCGGAAAGTGCGGGCTGGCCGTGGCTTCACCCTGACCGAGCTCAAGGTA
TGATATAACCTCTATTGTGGGAATGGGGGGCCTGTCCTGATCTTGGGACTGCCTGCTGACATGAGTTATCACTACAGGCT
GCTGGTGTCCCCCGACTTCTGGCCCCGACTATCGGTATTGCCGTCGACCACCGTCGCCAGAACCTGTCTGAGGAGTCTCT
GGCCGCCAACGTTGCCCGTCTTAAGGCTTACCAGGCGCGCCTGCTCGTCTTCCCCAAGAAGGGCGCTAAGCCGGCTATCC
CTGCCGGTTCCGCCGCCGCCACCATCGCCGGCGTTCTGCCTATCGTCCCCGTCCCGGCTGGCGTTATGGAGATCAAGACC
AGCGAGCTGCCGGCGCAGCTTGAGGGCGGTGCCTTCACCACCCTGCGCCTGGCCCGGTCAAACAAGAAGTACGCTGGTGT
GCGCGAGAAGCGGATCAAGGATCGCGCTGAGGCTGAGGCGAACAAGAAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62