GenePrediction:GLEAN_677 Details

Name: GLEAN_677
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1390285..1392811 (+ strand)
Length: 2527
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1390285..1390325 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_97:1390482..1390571 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_97:1390639..1392811 (+ strand)
Length: 2173
>GLEAN_677 class=GenePrediction position=GCSC_97:1390285..1392811 (+ strand)
ATGGACAGGATTGGCCAGGCTCGCAGCCAGCGCTCGGCTTGGTGAGTGCCTCCGGACTTGTGCGATCATCGCACTTAGCT
AACGACCGGGCCCCGTCTCTAGCCGCCGATGCCATGTGCGCAAGGTGAGCTGGTGGACCCCAGATCTGGGCGTGTCCAGA
AAAGACGTTTTGACTGACGTTGATTGGCAACAAACAGGTCAGATGCGATGCAACGCCCGGACAGCCGTGTTCCGGATGCC
GGTGTGCGGGGTCCCCATGCATCGCCCACGAGAAGCGGCGACGCAATGTAAGAAATGACTTTCTGCTGGTGATCACGGCC
TGACTTCAGTCCCAGAACTGACTGTCTGCCAGAGAGGCCCACCAAAGCCAACCACGCTGGCGACCATTTTGCCAACGCCG
GCGACCGGGGGCTCATCCAGCGCGGTTGACGGCCCTGCGGCGTCTGGTGGGACCGACAGCTTCCATCCCCAGCCACGAGA
CGATGAATGCCCGGGCCCTGATGACCGCGACAGTGAAGTCGACCGGGTGGCTGCTGCACTGTCATCGCTGCAGGATGCGT
CATGGCAAGACGGCAGCGACCATGGGGACAGCAACACGGCCGACTGTGGCAGCAACACCGTCCACAACGGAAACACAGCC
AACACCAACGATGACTCGGACTCGGACGGCACCTCGGCTGCACCGGCTGACGTCAGACGCCACCTGGTCGAGATGCTCTC
GCAGGAAGACATTGCCGATCGGGTGATGCAGCGCGGCGTCCGCATCGTCTACGTCGGCCAGGAGTACTCCAACATCCACT
ACCTGATCCGCCAGCGAGCCCGCCATGCGCCGCCTTCGGTCCACCACTTTCCGTCTAACCAGATCTCGCGCCGATATACG
AGCCACCAGCTCGACCGCATCCCTCGAAAGGCCTTTGCGCTTCCACCGGCCGCTGTCGTCGACGAGCTGTTGGCTGCCTA
CTTCCGCCATGTCCATCCCGGCTTTCCCGTCCTCGACGAGGCCGTCTTCATGAGCCAGTACCGTCGCCGTGACCCGCGCA
ACCCCCCCAGCCTTCTCGTGCTCCAGGCTGTCCTCATGGTCGGTGCTCATGTCTGCTCGCACCGGCCAGACCGCGCTGCC
CTCAAGACGAGCTTCTTTCGCCGCGCCAAGATGCTCTTTGACGCCCGTTTCGAGTGGAATCGCGATGTCGTCGTCCAGGC
CGCCCTGCTCATGACCTGGCACTCCGAAGGCGTCGAGGACATTGGTGCTAACTCTTACTACTGGGTCGGCGTGGCCGCTC
GCACTGCTCTCGGTCTCGGCATGCATCGTGACGCTGGCGCCAGCACGCTCGTCGCCCCGGACCAGCGCCTCTGGCGTCGC
CTCTGGTGGATCCTCGTCCAGTTCGACGTCATCGTATCGCTATCCTACGGCCGTCCACCGGCTGTCCGTCTGGATGAGAG
CGACGTGCCCGAGCTGAGGCCAGACGACTTTGATTCGCCTGGACACGCGACCGGTGATGACGACAACAACGTCCACAATG
GCCACAGCAACACCAATACCAACACCCAACCTCCTCTCTCTCCCATTCATGCCGACTTTACGATCCATCAGACTCGCCTC
TGCTGCATCATTGCCCACACCTTACGCGACCGCTTTGGCTTGCGCGTCCCGCCCGAACGCCGCAGAGCCGCCCTCGCTGA
CGCTGACCAGCGTCTTGCCCACTGGATGGCCACCCTTCCGTCGTCCCTGCGCCATCACCTGCTCGGCTGTTCCGGAAGTG
TCCATCCGGCCGCCTCTGCTCCGCCCTGGGTCGCCATGCTGCACATGACCTACAACAACTTTCTCATCCTCCTGCACCGG
CCGCCGCCTCCACAGCCCACAGCCACGATTGCTTCCAGTGTGACGAGCCAGGACGACATGGGCATCTGCTCCTCGGCTGC
CACGGCCTTGGTGCATCTTCTCGAGGGCGTGGCCGCCCGCGACGAGCTGCGCTTCCTCAACGTCTTCGCCGTCGACGCCG
TCTTCACCGCTTTGATTCAGCTCAGCGCCGAGATCCGCGTCACCAACCCGGTGCTAGCCGCTCACGCCATGCGGCGCTTC
GACTCCGCCATGGATATTATGCGCCGCCTCGCCGCCTTCTGGCTCAACGCCGAGATTATCCTGCGACTGTTCGAGGACAG
CTCCGAGCGCCTACGCGCCCAGCTGGTCATCGGCAAGAGCAGCGTCAGCACCGGCAGCATAGACTCTGCCATCTCGCCTG
CGGTCGACCAGCCGCATCATACCCGGGAGCAGCAACAGCCACTTTCGCCATCACAAGCTATCGACCCGGCCACGGTCGCC
ATGGCTTCACACGCACACGGCTTTGGTATGCCCGGACCACAGCATGTGGACGTTCTGCAGGCACTGATGCTCAGCCCGGC
CACTACGCTGCAGCAACACATGGCCTCAGTTAACGAACAGCTCGACTGGACGAACCTCTACTGGGAGAACTCGGGCTTTA
CATCCCTAAGTCCGTTTGCCGAGATGCGCATGTATCCTCCGTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62