GenePrediction:GLEAN_6780 Details

Name: GLEAN_6780
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:92702..91052 (- strand)
Length: 1651
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:92702..92211 (- strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_156:92134..92089 (- strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_156:92014..91767 (- strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_156:91708..91561 (- strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_156:91485..91341 (- strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_156:91253..91052 (- strand)
Length: 202
>GLEAN_6780 class=GenePrediction position=GCSC_156:92702..91052 (- strand)
ATGATTGCCAAGAAAAACATAGATGTTGCCATTATCGGCGGTGGACCCGGTGGTCTTGCCACGGCAATAACACTCTCCGA
GCTTCCTTTCATGTCGGTCACGCTTTATGAGCAGAACCCGGAGCCCCGAGAAGCTGGAGCAGGAATCAGCCTGAGTACAA
ATGCCTGGCGAGTACTCGACCTGCTCGGTGCCGGAAACCGCGTCAAGGGAGGCTCGAAACAAGACACCCACCAGAGGAAC
GCTTACACCGGGAGCATATTGAGCATCACAAGGCATCCCGAGCATTCCGATGCAGACAATCGCGGTGCCATCCGTGCTCG
ACGGACTCGGCTTCAGTCTGCTCTTCTGTCACGAGTACCAGATGACGTAATCTGCTTTAACAAGAAGGTGGTGGCCATTG
AGGATGTGCAGACGGGCGGGGTCCGTCTGCTCTTCCAGGACGAGACCGAGGCAACTGCCGACATTGTCGTCGGCGCAGAC
GGAATTAAATCGGTACGTTTACAAATCGAGCAGTCACTACAAAAGGCCGTCTTACACGAGCCAATGGATCACTACTAATC
CGTCCCAGATAGTGCGACGCGCCGTGTTCCCCGACCACCAGCTCCACTTCACCGGTACGTAAAGAGCAGACAGTGTGCCA
ATCGATATGTGTTCGTATACGAGCACAGAACATCGCTGACTCTCTTAGGAAACGTAGCCTGGCGCACCCTCGTGCCGCGG
ACGGCCCTGGCCCACCTCCCAGACGTCACGCACGCGACGGCCTGGTGGTGGGGTGAGGATGGCCATGTCTACTTCTCGGA
TGTGGATGACGAGAGTGAAACCGACAACCCTTACTTTGAGATAACCGTAAGATCGTACCATGAGCCTGAGATCCAGGGTC
AGACAGTGGTCTGGAGCATACCAGCCACAAACGAGCGTGTTAGATCTCGCTGCACGGTAAGTCGACAGGCTGCAATGCTA
CCATACAAGCGACTACCACTAAGAGGGACGTTAGAAATTTGACAAACGGGTGAGGGACGCCATCGGCACCGTTCCTGAAG
GCCAGTGGAGAGAGTTTGCTGGGTTTGCAGGGCCCCGTCTTGATGCCATTGTAGGATGGGACAAGGTAGTGCTTATTGGG
GATGCTAGTCATCCCCTCTCAGGTAAGTGTTTTGCAAGGAGGCTGTCTGAATTTCTCAAGATTGGAGATGTCAGCATCTT
GCTGATGCGCCGACCAGGTGCTTTCGGTTCCGGAGCAACATTTGCCATGGAAGATGCATGGATCCTAGCACGCGCCCTCG
AGCGCACGCAGCAGTCACCGAGTCAAGTCCGGGACGCCCTGGCAATCTTCGATGCAATCCGGTCTCCGTATTATGCAAGA
ATGTGAGTCTCGGCAGTCTTGTTCTGCTGTTTCAAGAACTGGACTGGCACGAAGCGAGTAAACAAACTCTGACATGGTGT
GCATCACAGGTACGAGCACCTCGACGACGCTGGCGTCAAGATCAAGAAGTCCAAGGCCGAGGCGAAAGATTTCGATGAGG
CTCTACGGGCCAAAATCAATTATTTCCTTCTCGGCGACAAGGACTTCATCTACAAGAATGACATTGCACGGATTTGGAGC
GACTATGTGGCTGCACAGCAAAGCCGGGGAGACGGCGTAGAGGCAGACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62