GenePrediction:GLEAN_6781 Details

Name: GLEAN_6781
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:85326..83306 (- strand)
Length: 2021
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:85326..85123 (- strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_156:85066..84988 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_156:84921..84840 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_156:84781..83734 (- strand)
Length: 1048
Type: CDS
Source: GLEAN
Position: GCSC_156:83671..83306 (- strand)
Length: 366
>GLEAN_6781 class=GenePrediction position=GCSC_156:85326..83306 (- strand)
ATGCGCTTCTTTTCGGCTCTGGCTGCAGTGTCCAGCCTGCTGTCGGCCTCGTCCCTCACTGTTCTTGCGGTTCCGGAGCT
CGCAGTCAACTCCGCACGCGCATCGTCGTGCAACACGGCATCGCTCCGATCATGCTGGACGGCTGGTTTCGATATCAACA
CGGACTATATGACCTCCACCCCGATCACGGGTGTGACTCGGACAGTGAGTTCTAGTCTAGCCCACAGCATTTTGAATGGG
CCCCGTGCTGACTGCTCCAGTATGACCTCACAATCACTCAAGAAACTGACTGGACCGGCCCTGATGGCCAGGTCAAGTCA
CTTGTCATGCTCATCAACGGTAAGGTCCATTTGCACACCCGCTTTCCAGGCACTGCCTCGTTCTCCTTCTGACACTCAAG
TGCAGGCCAATTTCCCGGTCCCGTTATTACTGCTGACTGGGGTGACACAATCTCTGTGACTGTCACCAACAAGCTTGATT
CCAACGGGTAAGTCTAGGCCCTCTGAAGACATCTGCTGGAGGACGTATGTTCTGACCCTTGTCAGTACGAGCATGCACTG
GCATGGCATCCGTCAGCTGAACAACAACTTGCAAGATGGTGTCAACGGCGTGACTGAGTGCCCCATCGCACCTGGTAGCT
CCAGGACCTATACATTTCTGGCAGAGCAGTACGGCACCACCTGGTACCACTCGCACTTCTCTGCTCAGTATGGCAATGGC
GTTTTTGGCACCTTGTACATTAACGGACCTGCATCGGCTAACTACGACATCGATCTGGGAACTTTCCCCGTCGGTGACTA
CTACTATGACACGGCTGACAACTTGGTTGAATACACCAAGAATCATGGCCCGCCGCCCAGCGACAATCTACTGTTTAACG
GAACGAACGTGCACCCAACCAAGTCGGGCCAAGGAAGCTACGCCAAGGTGACGCTGACCCATGGCAAAAGCCATCGGCTC
CGTCTCGTCAACCCATCGGTGGAGAACCATTTTGCTCTCTCCCTGGCCAGCCACAACTTCACAATCATCTCGTCCGACCT
GGTGCCTGTAGAGCCTACGACGGTCACACAGCTCTTCATGGGCCCCGGCCAGCGCTACGACATCATCATCACGGCTGACC
AGGACGTGGACAACTACTGGTTCAACGCGACCTTTTCGGCTGATGGTGGCTGCGGCAGTTCTATAAACACGGCACCGGCG
GCTATCTTCCACTACTCAGGTGCCACGGGCAGCGTGCCGACTGACCCTGGCGCATCCATCTCCGTGCCGAACTGTGGCGA
TATCAGCGACCTCAAGCCCAAGGTCTCACGTACTATTCCGGTGTCAGACTTCCAAGAAGCGGCGGCGAATACGTTGCCCA
TCAATCTGGTCGTGGACTCGACAGGACCGGCACTCTTGACTTGGAAAGTGAACGGCACACAGATCAATATCGACTGGAAT
GTTCCTGTTGTCGACTATGTCATGAAGTTCAACACTAGCTACCCACAAAGCGATAACATCATCCGCGTGCCGAAGGCCTC
GAGCGCCGAATGGGCTTTCTGGCTAATCGAGAACGATCCCACATTTGCCTTGGCACACCCGATTCACCTTCACGTTAGTA
CTGGCTTTATTCATCTCCTTTCGATCTGGTGAATGGCTTTCTAACCGATCTACAGGGACACGACTTTGTTGTGCTTGGTC
GCTCTGACCCGAGCGATGCCAGCCCGGCGGCCTTTGATGCCTCTTCGGCGACCCTCAACGGGGACAACCCGATGCGCCGT
GACGTTGCTATGCTGCCGGCGAAAGGCTGGCTGCTGATTGCATTCCGGATCGACAACCCGGGTGTCTGGTTGATGCACTG
CCACATTGCATGGCACGTCTCGGGTGGCCTGGGTGTCACCTTCCTCGAGGACCCCGACACTTTTGGATCGCAGGTGGCCT
GCTCTGATAAGAGGGCATTCAAGCAGACATGTGATGCCTGGAACAACTACTACCCCTCAGGCGACCCGTTCAAGCAGGAC
GACTCGGGTCTGCGGATATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62