GenePrediction:GLEAN_6782 Details

Name: GLEAN_6782
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:79726..78795 (- strand)
Length: 932
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:79726..79540 (- strand)
Length: 187
Type: CDS
Source: GLEAN
Position: GCSC_156:79487..79416 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_156:79339..78795 (- strand)
Length: 545
>GLEAN_6782 class=GenePrediction position=GCSC_156:79726..78795 (- strand)
ATGCTGTCACACGCGCTCTTCCTAGTTTCCGGCGTCATTGTTGGAGTCCTGGCCGAGGATATCGACTCTGACATGGGCCC
GGCAGCATTTTTATTTCCATCAGACCGTGCCTATTCGGCATCCCTTGACAACACCGCACCTTGTGGCTCCGTCGCACAGG
CTGGCAACCGGACTGACTTCCCGATAAGTATGTGTATATGTTGATTTTTTGGACGTGCTATGCTAATACAAAGCATTAGC
GGGCGGTTTCGTCGGCCTAGTAGACCAGGAGGAGGCCTATGATGTCCAGATATCTATATCTTATAGTGACAGTACGCCCT
CCTAGTTTAAACCTACCCCTTGTTCCTCTATGCGGCTGGTCATGCTGATTTTACGTTTATGTCGAAGACCCTCTCACGAA
CAGTGACTTTGAAGTCCTTGTCTCGTCAAAGAGGATAAAGGATCTGTACGAGGGACATACGTGCATCATTCTTCCCAACC
CACCGAGCAACATCTCTGTCGGCGATGTAGCTACACTGCAGGTTATCTACGAGTCCGTCTGGGACGACTCTACAGTCAAT
CAGACATTTTACGCCTGTGCCGACATCAAGTACATTCTAGATGCGGACTTTACACAGAACAGCTACTGCTTCAATGCTAC
TACCGACAGCAACACTGCCGCGACCACCACGGCCACTTCCTCCAGCGGGACCGAGAGCATTTCCACAAGCAGCTCCAAGA
AGTCGAAGAAGGGCATCTCCAACGGTGCCATCGCCGGTGCCGTTGTCGGCTCCGTGTGCGGTGCTGCAATCTTGGTCGTC
GCTGGCTTCCTTCTCTACCGTCTGGGCGCCACGCATCAGCGACAATTGCTGATGCGCTACCATATGAACAATATGGCACT
GGGCGAAATGGGAAACAAGACACCAGAATCAACGACGAGCAGCACAAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62