GenePrediction:GLEAN_6787 Details

Name: GLEAN_6787
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:50621..47636 (- strand)
Length: 2986
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:50621..47868 (- strand)
Length: 2754
Type: CDS
Source: GLEAN
Position: GCSC_156:47818..47636 (- strand)
Length: 183
>GLEAN_6787 class=GenePrediction position=GCSC_156:50621..47636 (- strand)
ATGGCGCCTCCCAGCAATGGCAACGGTGGCGGGCCGTACGACCCCCCCATACCAACATACGAGCAGGCCGTGTCTAGCCA
CGCCAATGTGCAGCACTTGTCGCTGGGTGGAGCCCTGCCTTCTCCTTCCACCTTCGATCCGCTGTCGCCGATGGGCGAGG
CCTACTATGCCCCCGAACACGAGAGCCGCTCGCTGCTGCGACGGAGCCACCAGCGAACTTCATCGACCGGAACTGAGCCA
GTGGCTGGGTCGGCTGGCGCGCGCTCACGAGCAAGGCCGAGCGGCTACCGGCCGCCAACGGTCGAGACGGACGACGAGGA
CAGCACATGGAGCTCGTCCGAGTCAGAAGACGGCCACGACGACGACGCCCATACCGAAGCTGCACACGTGCGCCGGGAGA
TGCTGGAGCTGGATATGGAGGACCCACTCAGCACCGACGGGCGAGGCCAGCGCGGCCGCTCCTCCATTTTCGGGAAGACC
ATTGGCTTCTCGCTGCCCAAGTGGAAGTGGAACTGGCGCTGGTCGATGCCGCGGCTGCAACTGCGGCTGCCCAACGGACC
GCAAGGCAGCACCGGCCTCGGCTTTGGGAGCCGATTCGGCGGCCGCTTGGCTGGATTCTCGCCTATCCACAACGGCGACG
GCGAAGTCGACTTGGTCGATGCAAGCACGACCACTTCACCGGGTGCAAACGGCGGCGATGCATCTGCGTCATCTTCGGCG
AGACGCTGCCGCTGCTGGCCGGCCTTCCAACCGTCTAACTCGGCGCCGTCGTTGATTGTGTTCGCACGCATCTTTGTGCT
TGCGCTCATCCTTGGATTTATCTACCTGATCTTCATCAGCGACCTCTTCTCGTCCGTGTCCCGCCGTCTCGGCAACCAGG
CCTTCGACCCCGAGAGCGTCCGAATGTTTATCCAGTCCCAGGTCGATCCGGCATACATGAAGGATATGTCCAAGCATCTG
ACGAGCTATGCGCACATGGCGGGTACTGAGGGCGACTTTGCCGTGGCCCTCGACGTGAAGAATCTTTTTCAGCAGTACGG
CCTGGAGAGCATTACCGTGGACGAGTATTACGTCTATCTCAACTACCCAACTGCGAATGGACGTGCTGTTGAAATTATCG
GCGACGACGGAACGGCGACTTGGAAGGCCAAGCTCGAGGAGGACGACATGGGCGGCGAGACAGCCGGCAACCAGACGTAC
GCTTTCCACGGCCTCTCCAAGTCTGGTGACGTCCATGGCCCGCTGGTATATGCCAATTACGGTTCCCGCGAGGACTTCCA
GAAGCTGCACGACAGCGGCATCGAGACCAAGGGCGCCATCGCCCTTGTGCGCTACTATGGCACACAGCCGGACCGAGCCC
TCAAGGTGAAGGCGGCCGAGCTGGCTGGCTTTGCCGGCTGCCTCATCTACAGCGACCCGATGGAGGACGGTTTCCTCCGG
GGCACAGTGGCACCCGATGGTCCCTACATGCCGGCCGATGGTGTGCAGAGAGGGTCCGTCTCGTTGATGAGCTGGGTTGT
TGGCGATGTGCTCACGCCTGGCTGGGAAAGCAAGAAGAAGTTGCCGCGGATGTCGCCGGCAGCTTCGCCCGGCCTAGTGC
AGATCCCCAGTCTACCGCTGGCCTGGCGCGACGCTCAGGTGCTCCTGCAGCACCTTCGTGGCGCTGGCGTGCGCGTGCCC
CAGGGCTGGGAGGGCGGCGTGCCTGATGTGGACGAGTGGTGGACGGGCAACGCTACCGGCTCGCCGATTGTGAGGCTCAA
GAACGAGCAGGACGAGGTGACGGAGCAGCCGATCTGGAACGTGTACGGCCGCATCGAGGGCATTGAGCAGGCGGCCAAGA
AGGTGATTTTGGGCAACCACCGGGACGCCTGGACATTCGGCTCAGCAGACCCTCATTCGGGCACGGTTGTGATGCTGCAG
ATGGCACGCATCTTTGGAGACTTGCTGCAGCGCGGCTGGCGGCCACTGCGCACCATCGAGTTCATGTCGTGGGACGCCGA
GGAGTACAACCTGATCGGATCGACTGAGTACGTGGAGAACAATCTCGGTGCTCTGCGCAGCGACGCGCTCGCCTACTTGA
ACCTGGACACGGCCGTGACGGGCCAACAGCTGCACGTGGCCGGCTCCCCTGTCTTCTCCAAGGTCTTGGTGCAAGCCATG
AAGCGTATCAGCGACCCCAACGGCAATGCGTCGCTGTACGATATGTGGCAGCGCCACGGCAGCTACTTGGAAGTGCTCGG
AGCCGGCTCCGACTACGTCGCCTTCCAAGATATTGCCGGCACCTCCTCACTGGACCTGCATTTTGATGGACCCGAAAATG
CCATGCCGCTGCACAGCGCCTACGAGAACTTCGACTGGATGGAACGTGTCGGCGACCCGGGATTCGTATACCACGGCATT
CTCGGCGAGCTGATCGGCCTGGTGCTCATTGAACTGGCTGATCGGCCCGTTTTGCCCTTTGACATGGCTGCCTACGCCAA
TGCCCTCCAGATCTGGGTCAAGGAGCTGATTGCGTGGGTGCGCGATAAGAGCGGCGAGAACGCCGCCCGTATCGATGTCG
TAACCCTGCAGGAGGCCACCGGCAAGGTCGTTTCCGCTGTCGCCGAGTTTGAGGGCTGGGAAAGGAGCTGGGAGGCCGAG
GTGCTGTCCGGGGGCGGCTGGGAGCCCAGTAGTGTAGGCCGTCAGCGGGAAGAGTACAATAGCCGCATGGGCATGTTTGA
GACTGACCTGCTGGATCTGGCCCAAGACGGAGGTGTACGTATTTCTTCAGTCTTTGTTGTTTTCCTTGCTAATCCTCGCA
CAGATCCCCAACCGGACGCAATTTCGCCACATTCTCTACGGCCCCAGCCTTTGGGACAGCTACGAAGGCGATCTATTTCC
GGCTGTTCGAGACGCAGTCAATGTGGCTGACTGGGCGCTGGCAAATCGTACTGTCGCCAAGATATCTAATATCCTGCGCA
AGGCGGCAGACAACCTGGTGGAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62