GenePrediction:GLEAN_6788 Details

Name: GLEAN_6788
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:42406..40741 (- strand)
Length: 1666
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:42406..42181 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_156:42106..41202 (- strand)
Length: 905
Type: CDS
Source: GLEAN
Position: GCSC_156:41112..40741 (- strand)
Length: 372
>GLEAN_6788 class=GenePrediction position=GCSC_156:42406..40741 (- strand)
ATGCAAAAGGTGACAGCAAAGCTGCCGTCTTGGGACCAGACCAAGACAACAGGCAAAAAGGGGTTTGACCAGGGCAAAAA
GGGCTTCGACAAGGTCTGGGGATGGGCGGACAAGCTTGGGGCTCCGGTGAACCGGCTGTCAAACCGGATTGGCAGCGAGG
CCTTTTGGCCAACAACGTTGGACAAGGAAAGCGACAAGGCGGCACGCATATTGCGATCGTTCTGCAGTGAGCATCCTTTG
AGCGTCTCTGGGGGAAGATGTGCGTCGTGAGGCCGGCAGACTGACGGGATGACGTCACAGAGGATGGCTTCTACACTGAA
GAGGTGCAGCAGACGACGGCGGATGGGCCCAAACAGAAGCAGCGTGTGCTTAAGAAGATTCCGCAGCGGGTGATCCAGAA
CGCCGTTGGACTGGCCATCTTCACCACCATGAGGACGGGTCTTTGGGTGTCGGGTGCTGGCGGGTCAGGCATCCTGGTCG
CACGAAAGGAGGATGGATCCTGGTCGCCGCCCTCGGGAATCCTGCTGCACACGGCCGGACTGGGCTTTCTGGTAGGCGTG
GACATCTACGACTGCGTGCTGGTGATCAACAACAGGAAGGCGCTCGAGGCATTTACTAAGATCCGCGCTACGCTGGGCGG
CGAGATCAGCGCTGTGGCCGGACCCGTGGGAGCCGGCGGTGTGCTAGAGAACGACGGCAAGTGGAAGCAGGCCAACCGGC
CGGTCTTTACGTACCTCAAGTCGCGCGGCTTCTACGCCGGCGTCCAGGTCGACGGCACCATCGTGATCGAGCGCACTGAC
GAGAACGCGCGCTTCTACTGCGGAACGGTTGGCGTGACTGACATTTTGGCCGGCCGAGGCGTTGCTGCCCATCCGCCGTC
CGAGATCCGGATGCTGATGGAGACGCTCAAAGCAGCCGAGGGCCGTACCGACGTCGACTCTGATTTGATGGACGAGCTCG
AGGGCCAGCCAGCGCCTGGTGACGTTAGCGTCGATGCGCCGGGCACCAACGACAAGGCCGAGGATGGTAGCTCGCTCTTT
GGCATCCCCGACCCGGAAGACCCAGACCCCTACGGTGTGCTCGCATTGGAGAAGGAGGGCCTCGAGGTGCGCGACGCTAT
CACTCGCTCACGTCCGTCCAGCCAGCAGTTCGAGTTCAACCCCAGTCCAAGCAGCCCCATCTACGGCCGTTTTCACCGTC
TTAGCGTCAGCAGCCGTAATCGCTGGAGCACTGACCGCAGCTACACCTGGGCCGACGCTGAAGTCCAGACAGATCCAGTC
ATCGTCACACCCAGGTCGTACCAAGTCTGGCCGTTCCAGCCGATGGGCATACCGCCGGCGACATCACTTCGGACGAGGAG
AAGAGTGTGTACGAGGATGTAGCCGAGCCGGCTGACCTTGTTGCCCCGACGGACCCGCATACACCCCCAGCAGGCGCTAC
ACCTTACAGCGACAACCCGTGGGAAACGGAGAAGCCCAGTAGTGTCACAACTACAGAAAACCCGATTGTCGAAGCACGGC
CACCTGTCACACCCACTGCCGTCCTACCAAGAGGTCCCCCACCACCACTACCACCGAGAAACAGCATGCACGTCAAGCTA
GAGCTTGAAGATGTCAGTCTGCAGGAGGAAATACCGGAAACAAGCAATGAGGTGACTGTAACGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62