GenePrediction:GLEAN_6789 Details

Name: GLEAN_6789
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:35261..26301 (- strand)
Length: 8961
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:35261..35079 (- strand)
Length: 183
Type: CDS
Source: GLEAN
Position: GCSC_156:35011..34925 (- strand)
Length: 87
Type: CDS
Source: GLEAN
Position: GCSC_156:34862..34805 (- strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_156:34612..26301 (- strand)
Length: 8312
>GLEAN_6789 class=GenePrediction position=GCSC_156:35261..26301 (- strand)
ATGGCCGAACAAGTGTCCCCTCTGGCTATTGTCGGCCTCGGTGGACGGTTTCCAGGCAAGGCCACCGATCCGCTGAAGCT
CTGGGAGATGTGCTCCGACGGCGAGGATGCCTGGACAGAGACGCCATCAACAAGATTCAATCCAGAGGCTTATTACCATC
CAGACCAAGCCCGAAATGGAGCTGTTCGTACTGTCCCTTGACGAATCCCCGCTCTATTTCCCTATGGAGTTTTACTGACA
CCTGCTGCAGACCAATGTCAAGGGGGGCTTCTTCTTGCGCGAAGATGTGGCCCGGTTCGACGCTCCCTTTTTCAACATGA
CCAAGGCAGAAGCAGCAGTACATTTGAATTTCCCCTCCCGATTTCACTAGCATAATGCTCCAGACTGACACGATCGCAGT
CTCTTGACCCGCAGCAGCGTCTTCTACTCGAGGGCACATATGAAGCTCTAGAAAACGGTCAGTTCGTGCTTACAATCCAC
TCACTTGCATCGCCGCCACTACCTTGCCTCGCCTAATCTCACCTCTGCATCACCTCCCCTCCTCCTCGTTGTCTACGCCT
TTCGGCCCACACCTTCCACTTCTCCATTTGCATTCGTACCCACATACGCCCAGCCAAAGCTGCATGCAGCTCCATGCTAA
CATGTATAGCCGGGATACCACTGGACCATGTGTCGGGGTCGGACATGGGCGTCTTCGTCGGCTCCTTCTGCTTTGACTGG
GCCAAGATCACATTACGGGACCCAGACGCCCTGCCGCTGTACCACGCCACAGGGTCGGGGCAGGCGATGCTGGCAAATCG
GGTGTCGTACTATTTCAACATGCATGGGCCGTCAGTGACGATGGATACGGCGTGCTCTTCAAGCTTAGTAGCGCTGCACC
AGGCGTGCCAGGCTTTGCGGGCAGGGGAGTGCAGCGCAGCGGTGGTGGCGGGCGTCAACTGCCTGCTGTGCCAAGACTCA
CTGGGCTCGATGAGCACAATGGGCTTCCTGTCACCAGACGGGCGGTCTTACACGTACGATAGCCGCGCAAACGGATACGG
TCGTGGCGAGGGCGTGGCCGTGATTGTTCTGAAACGGCTGGACCGAGCGCTTCAAGAGGGCGACGCCGTGAGAGCTATTG
TGCGAAATACCGGTGTCAACCAGGACGGCCGCACGCCGGGCATTACCTTTCCAAGTGGCACTGCCCAGGCCGCGCTGATC
CGCCGCGTATATGCACAGGCCCGTCTCAACATGGCGGACACGTCGTATCTCGAGGCCCACGGAACTGGCACGCAGGCCGG
CGATCCCATAGAGGCCGGCGCACTGCATGAGACATTTGGCCTCGCACGTGCAAGCGCTGGGAAGGGGCCTCTTGTTGTCG
GTTGTGTCAAGACGAATATTGGCCATCTGGAGGGTGCTGCTGGTGCAGCCGGCCTAGTCAAGACTGTGATGATGCTAGAG
CGCGAGGCCATTCTACCCAACGCCGGTTTCCGGTCTCCCAACACGAAGATCCCGCTGGCCGAGTGGAATTTAGAGGTTCC
AACAACCCTGCGTCCATGGCGGGATGTCCTGGCGACATCCTCGCAGCTGCCCCGAGGCCGCTTGCCCGTGCTGCGGGCAT
CAGTCAACGGCTTTGGGTACGGCGGGACGAACGCGCACGTGATCCTGGAGAACGCAGCAGACTACATCCACACGTGCAGC
ATGGCGGCAAGCATGTCGGGCTTCCGGCACGGCCACAGCCTGTCGCTAGATAGCTCATTCAGCACGGCAACTAGCGCGTC
TGTGGCGCGGTCGCACAGCGCGGCTTCGTCGACATCATCGCCACCGACAAGTCCCATTGCTGAGTCAGCAATGACTAAGG
AGCCTTTGCCAGTGGAGGCAGGAGCGACGGTCGAGCAATCAGCAGCTGCAAAACTCATCCAAACTGCCAAAACAACATCA
GAAGTAGAGGCGGAAACGAAGGCCGAAAATGGAGGTGCACTTCCTCTGTTACCAGAGCACCTGGCGAGGCTCAATCGCTC
GACACCCAAGGAATCTTTCTCCAAGGCAGCGAAGCTGAGAGTGCCCCATCTGTTTGTGCTGACGGCAGCCGACGAAGCAA
GTGGCAAGACACAGGCGGCCCAGCTGGCAACGTACATGGAGGAGGCCGACAAGCCGGAGGAGCTGCAGCTGCTGGAAGAC
CTGGCATTTACTCTGGCGACACGGAGATCTGGACTGGCATGGAAGGCAGCAGTGGCCGCAGCATCGGGCGCAGAGCTGCG
AGAGGCGCTGTCAGGACTGCGGTTCCAGCAGACGGTGCCATCATCGAGCAAGAAGATGAGAGCTGGCTGGGTCTTCACCG
GCCAGGGCGCACAGTGGTGGGCCATGGGACGCGAGCTGGCACGGACAAGCACAGCATTCAGGGTATCCCTGGACCGCAGC
GCAGCGGTACTGACATCGTCGGCCTTGCAAGCTGACTGGTCGCTGGACGAGGAGCTGCTGCAGCGCGACGCGGAAACGTC
ACGGGTCAACGAGCCGGCAGTCAGCCAGACGCTGTGTACGATCGTGCAGGTGGCCCTGGTGGACATGCTGCGGGCCTGGG
GCCTGCGGCCGTCGGCCGTGGTGGGCCACTCGAGCGGCGAGATTGGTGCGGCGTACGCAGCCGGACTGTTGAGCCACGAA
GCGGCTGTGGCAGCGGCCTATTTCCGGGTGCCGCTCGACTCCGAGGCTGCACAGGCCTGTCGCGGCGGTATGGTAGCGCT
AGCTTGCTCCGAGGCCGAGACGCTGGCCCTTCTGGACGGTCTGCAGCGCGGCGGTCGTGCCGTCATCGCCTGCTACAACA
GTCCGCAAAGCTTCACGGTATCGGGTGACGATTCGGCCGTGGACGAGCTCGTGGACGTGTGCAGAGAGCGTGGGATTCGC
CACCGCAAGCTGGTTGTGGCGTTTGCATACCACTCGCACCGCATGGCCGTCGCGGCCGAGGACTACCGCAGGCTTCTGCA
GGCCAACCGCACGGTCATGCAGACCATTGACGAGCGGCAGATAGCCGCAGACGATGGCACAGAGGCGCCGGCAGTCATGT
TCTCATCAGTCACTGGTGCCAAGCTGGCACCCGGCGCGCTGACGGCCGACTACTGGGTCGACAACCTGGTCAACCCGGTG
CGCTTCACCGAGGCACTGATGGCGTTGTGCAAGGACGGCGGCGGCAAGGGGCCGGCCGTAGATGCTCTTGTCGAGGTTGG
CCCGCACTCGGCGCTAGCTGGACCGATCCGGCAGATCCTGCAGGTAGACCCGTCGCTGGGCAGCAAAGTCGGCGTGCTGG
GCGTGCTGCGCCGTAATCAGGACGCCACCGAGACGGCACAGGCACTAGCAGCGGCACTGTTCTCACGGGGCCTGGCCATC
GACATCGCGGCCGTCAACAAGGACGCACGAACGAGCCCGGCCTTTGGTCCGCCAGGAATGATGGCACGGCTGCAGACCAT
ACCGCGACTGCTGACTAATCTGCCCAAGTATCCGTGGAACCACGCGACGGCGTACTGGGGTGAGCCGCGCGAGAGCTGGC
GGTACCGGACGCGGACACACGGGCGCCACGACCTGCTAGGGGCACCAGTGCGGTTCGGCAACCCGCTGGAGCCGCGATGG
CGGCAGTGGATCCGCACGGCCGAGACGCCATGGATACGCGACCACCGGGTGCAGGGCCTGGTGGTATACCCGGCAGCAGG
CTACCTCAGCATGGCCATAGAGGCGGCGCGCCAGACGGCGTCGACGACGGCGGAGGATGGGGTGACGATTGCGGGCTACG
AATTGCGGGACGTGTCGCTGGGTCAGGCGCTGATCGTGCCGGACGACACGGGCGAGGTGGAGGCGCAGATCAGCCTGCGG
CCTCTGGCCGAGAACGCGCAGGACAACTCGACCGTGTGGCATGAGTTTTTCGTGTACTCGTGCAGCGACAGCACGCACAG
CAGCACGAATCCGATGGGCACGCCGGTGGTGGACCGCTGGTCGGAGCACTGCCGTGGACAGATTGCAGTGCGGTGGAAGA
CCAGCGAGGCTGCCGACAGCGATTTGGTGACCGACATGGATGCGCTACGGCGCGAACGGGCGCGGTTGGATGCGGCTGTG
CGCGCTGAGACGGAAGCGCTTTGCACACGGGATGTCGACCTCGTTGGGCTGTATGCGTACTGCACGGCCATCGGGCTGGA
ATATGGGCCGACGTTTGCGAACCTGACAAATGCGCGCTCTGGACGGTCGGCGACGGACGACTCACGACGCATTTCTGGCA
CGGTGACAGTGCCAGACATTGCGGCCGTGATGCCGGCGCACTACCACAGCCCGATCGTGGTGCACCCGGGCACGCTGGAC
GCGTGTCTGCACGGGATCATGGCGTTCCGCGAGCTGCTACAAGCGGCCGTGATGCCAGTGTACTTTGGCTACATGTATGT
GGCGGCCGAGCTGGGCCAGATGGATGCCGGCGATGCGCTGGGCGTGTATCTCAACGTGAAACGCAGCGGGTTCCGCAACC
TCAACATCGAGCTGACCGGCTGGAACGGGGCCGAGCAGAAGACGACGGCGGCAGCCGCTGGTCCGCTTATCCGCATGGAA
GGCCTGCGCATGACGTCGTTGGGTGGCAGCATGGGTGGCAACGGCAGCAGCGGACTGCCGTCAAAAACCTATTTCCAGAC
AGCATGGCGGCCAGACCCGGCATTTCTGACACCAGGTCAGTTCGACGCGCTGTGCGCGCACCTGATGCCGGCCGAGGCCG
AGACCGAGCTGCTGCGTCGGCTGGACCAGTCGTCCTTTTACATGGCGGACGGAGCGCTGGCGCAGATCCCAGCCGACCGG
GTGGCCTTGCTCTCGGTCAAGGGCCGCAAGCTGTACGGCTCGCTGCAGCGCCAGCGTGACGCGGTACTGCGGGTGCAGGC
CGAGGAGGTGGCCCGGAAGGGGGCTGAAGCAGTGGCGCGGCGAGCAGTGCACGTGAGCGATATGGCGTCGTGGCCGAACG
CGGCGGCGGAAGAGCGGGCAGCACAGCTGGCTGAACTCGAGCAGACGGCGACGGCTGAGGGCCCGCTGCTGGCAGCGGTG
ACGGCCAGCATGCACAAGATTGTGCTAGGCGAGGCGGATCCGCTGGAGGTGACGATGAAGGGCGACGTGCTGGGACGGTA
CTACGCTCTTAACCCGCGGATGGCGCGGCAATACCAACAGGCGGCCGTGTTTGTGGACCTGTTGGCGCACAAGAACCCGG
CGATGCGAATTATGGAGATCGGCACAGGCACTGGTGGCGCGACGCTGCCGCTGCTGGAGGCGCTGGGACGTCCAGACGGA
GCGTCCGGCGGGACGGTGCCGCGGTTCGAGACGTACGACGTGACCGACATCAGCTCGGGCTTCTTCGAGGCGGTGCGGGC
CAAGACGCGGCCGTGGCAGTCGCAGGTGCGCTTCCGGCGGTTGGACATCGAGCGGCCGCCGACAACGCAGGGTTTCGAGG
CCGGAACATACGACCTGGTGGTGGCGGCCAACGTGCTGCATGCGACGCACAACATTAGCCGCACGGTGGCACACGCCCGC
AGTCTGCTGCGGCCCGGTGGGCGACTGCTGCTGATCGAGCTGGTCGTCGTGCCGGAGCAGCGCGTGTGCTCCGTGGCGAC
GCTCTTTGGCATCTTTGACGGATGGTGGAAGGCCGAGGAGGCCCACCGGCAGGAGTCGCCTCTGCTGGCCGAGAGCCAGT
GGGACGAGGTCCTGCGGCAGAACGGCTTCTCCGGCCTGGACGCGGCCGTGTGGGAGACGTCCGACGTGGCGACGCATCAG
GGATCGATGATGATCAGCACGGCTGTGGCGGAGATGACACTGCCAAATGAGACGGTTGAGCCGTTGAAAGCTTTCGCAGA
CATTAGCAAGCTGAAAGAGGTGGATGGATGGACAGAGCTTCAAGCAACACCAACGATCGAGACTGTACTGGAGGCCTTTC
CGGAATTGGCGGAACACACTGTCATGGCTTCCGAGCCTGTGGTGGCTGTCACAGCTGATGTTTCGAATCACGTACCGCCA
GACACCACACTCCCTCCTGTCGTCCTCGTCACGGACAGCGCAAGCCAAACAGCATGGCTGCAACAGGTCGGCCAGGCACT
CATGCCGTCCTTGTCTTCTCCGGTCATGCTAGTAGACGAAGCCGAGCTCACGATCCCAGACGGCCACACGGTCGTGTTCT
ACCAGACAGATGCAAGCACGCTAGGCGCGCAGACGGCAGAGAGCATGGAATGGATGCGGCGGCTGTTTGTGCGGCCAGCC
GACACGGCAGCAGCAAATGTGCTGTGGCTAACACGTGGAACGGCGAGCGGCGAGAACGCGCCCGACTTCTCGCTGGTGCA
GGGGCTGATGCGAACATTGCGGGTAGAGCTGGGCGGCCGGCTAGTTCACCTGGACCTGGAGGTAACAGAGAGCAGCGCAG
ACATCGGTACCGTGGCACGGGTGTTTGCCCAGTCGTTTGGGCGGACGGGCCAGGCGGACGAGGACAGCATTGCGAGCACG
ATGGAGGTGGAGCTGGAGCTGGCGGTGCGCGAGGGCATGGTGCACCTGCCGCGATACGTGGAGCAGGAGACGACAGGCGA
GTACGTGGCAACGCGAATGGGCCGACGACACCTCGTGGACGCACCGGCCGTGCAACCGGGCCGCAATCTCAAGCTGGAGG
TGGGCCAGCCGGGCCAGCTGGACAGCCTCTTCTTCGACGACGACACACGACTGCTAGCAGCAGGCAACGACAACGACAAT
GGCCGGGCAGCCCCGCTGGCCGACGACGAGATCGAGGTGGCCGTGCAGGCAGCCGGGGTCAACTTCCACGACGTCATGGT
GGCCATGGGCCAGCTGGCGAACCGCAGCCTGGGGATCGAGTGCGCGGGCATCGTGACGCGCATCGGGGCACGAGTGAGCA
GCAGGCTGCAAGTGGGCGACCGGGTAGCAGGGCCAAGCGATGGGACATTTGCCACGACGGTGCGACTGGCGGCATGGCGA
GCACAAAAGGTGCCGGACCACGTCAGCACGGCAGCAGCAGCCGGACTGCCGATTGTGCTGTGCACGGCAGTGCACTCGCT
GCGGGTAGCGAGACTTGCAGCTGGCGACACGGTGCTGATTCACGCAGCTGCCGGTGGGCTTGGCCAGGCGCTCGTACAGC
TTTGTCAGCAGCGTGGAGCAACGGTGTTGGCGACAGCCGGCACGCCGACCAAGAAGCGCTTTCTCGTCGAACGATGCGGC
CTGGCAGCCCACCACGTCTTCAGCAGCCGTGACGCGTCGTTTGCCGAGGCAGTGCTACAGGTCACCGGTGGTCGTGGTGT
CGACGTGGTGTTCAACGTGCTTGCCGGTGAGCTGCTGCACGCGTCTTGGCGCTGTGTCGCGCCCTTTGGCCACTTTATTG
AGCTCGGCAAGCGCGATCTGCAGCGCCACGGCCGCCTCGACATGGCCCCCTTTCTGCGCAACGTCACCTTTGCCGCCGTC
GACCTGATCACCCTGCTGGCTGATCGACCAGACTATGGCGCCCGTCTGTGGGCTGAGAGCATGGATCTTGTCCGCCAGGG
CGTCGCTCGTGTGCCCGAACCCCTGGCCACCTATGCCCTGGCTGATGCCATCTCCGCCCTACGCACTATGCAGGCTGGCC
GTCACATCGGCAAGCTCGTCCTGGTCGCAGACTCGTCTGTGACCCCGTCTGTGACCACGACAACAAACCCCAACATCCTC
GCTCGCGTCATGTCACCCCGCGTCCCCCGCGTCCAGCTCCCTGCCGACGCCTCCTACCTCCTCGTTGGTGGCCTTGGTGG
CATCGGCCGTGCCCTCGCTGCTCGCATGGTCCACGAGCTCGGCGCCCGTCACCTCATCTTCCTCTCCCGCGGCGGCATCA
CCAGCGATGTCGCTGCCTCTACCGTCGCCCGTCTGCGCGCCGCCGGTGCTCACGTTCTCGCCTGCAACTGCGACGTCGCC
TCCGACCACCAGCTCGCCGCCGCCCTACAGGCCGCTTCCGAAGCCGGCTTTCCCCCCATTCGCGGCGCCGTTCATCTCGG
CCTCGTCCTCGAGAGCGCCCTCTTTCAGGACATGTCCTCTGCCGCCTGGAACAACTCGCTCGCGCCCAAGGTCGCCGGCA
CCTGGAACCTGCACCGCCAGCTGCCCGCCAACCTCGACTTCTTCGTCCTGCTCTCCTCCATGGTCGGCATCATCGGCAAC
CCCAGCCAGACCGCCTACGGCGCCGCCTCCGCCTTCCAGGACGCCTTTGCGCGCTACCGCCGCCGCCGCTGCCAAGCTGC
CACCACTATCAACCTCGGCATGATCACCGGCATTGGCTACGTCGCCGAGCACTCCGACGTCCAAAAGACCCTGCGTACAC
ACGGCTTCGACGAGATTGACGGCCCTGAGTGTCTAGCCATCATCGAAGCCGCCTTTTCCGCCCCACCCGACGCCACAAAC
GCCACAAACGCCACGCTTTCACACCCCAAATCAGCTACAGCCTCAGCCACAGCCACGTCCATGCCCCTGCTCGATGCCAA
CATTCTCACCGGTCTCGGCCTCGGTCGCTACACCGGCGGCGACATCCACCGGCCTTCCTACCTCGAGCCGCGCTTCGCCC
AGGCCCGCCATCTCGCTCAGTCTGCCACTGACGCCGACGCCAACAAAGGCCAGGGCACCGCTGATGCTGCCGACACCGCC
ACCCAGTCCATCCGCGCCCGCCTGCGCGCTGCCGACGCCCTGTCCGACATCCTTGCCCTGCTCGAGGCCGCTCTGCGCGC
CAAGATCGTCTCCCTGCTCATGCTGCCGTCCGAGGATGACCTCGACGTCCAGAAGCCGCTCAGCCAGTACGGCCTCGACT
CGCTCATCGCTGTCGAGCTGCGCAACTGGGTCGCCAGCGAGATGGAGGCCACCGTCCCCGTCCTCGAATTTCTTGGCTCC
CGCACCGTCCAGTCCCTCGCCGGCTTCATCGCCCGCCAATCCCGCCTCGTCAAGAAGGAGCTGCTGGCCACCGAGCATTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62