GenePrediction:GLEAN_6795 Details

Name: GLEAN_6795
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1756960..1755173 (- strand)
Length: 1788
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1756960..1756819 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_108:1756704..1755173 (- strand)
Length: 1532
>GLEAN_6795 class=GenePrediction position=GCSC_108:1756960..1755173 (- strand)
ATGGCACAGACGTCAAGCGCTCAACTTTTCAAGCTTGTTGGGGACACACTCGCTGGACAATACGTCAATATTGATAAAAG
CTACACGCTTGATGATATTAAGAGAGCAGTCGGGTTGACATTTCACGTCGCCAAACCGGAGGGTAAGTCGTCCCCACCCA
AAATTCCTACGACTTTCCTCGAATCAAAAGCTTTGGGGTCGTAACGCCTGCAAGTAATGATCTCTGTCGATAGAATGCTG
ACGGATTCTTACGTAGGAATCACCTTTCACACCTCGCCAGAGCAGCATGGACAGCTAGAAAATGCCTCGGATATTATCGC
TGCCAAGGCACCTGTTTCAGTCCGTATCGATGGCAGGGCTGTGCAAGACCCCCAGGGTCCAACAGAGCTACCATTTGTAG
GAAACTTCCACGAGATCTATCCGGATCACCTAGGGAACCACTTTCGACTCTTTCAAAAATATGGTCATGTCATACGGACA
ACAAACATGGGGAAAACGACATACCTCACCAATAGCCCAGATGTTACACATGTGGCCATGATGGAGTCTGTCTACTTCAC
CAAGAAGATCAACGAAAATCACCCTCTTTGGGGAATTAAAGACAACACGGCCATGTTTGTCGGAGACACAGAGACCGAGA
ATTGGCGCATCGGACACAAATTTCTCCCAACAGCGATGGGACCCAAAGCCGTGCGCCACTATACGCCTCTGATGCAAGAG
TCTGTGCGGAACTCGTTCACTGTTTTTGACGAGCTTGCCGAGTGCGGCAAAGAATGGAACGTGTACCCGTTTATGGTCAA
GCTGGCATCGCAAACCATTGGAAAGTTTGCCCTTGGCATGGATTTTGGTCATTTCACCAGCGTCGATGCAAAGCTACACC
CACTCATCATGAGTTTTGGCGCCCTATTGGGTCTAAACAAAAAAGTTACTTCCCGGGGCGAGTGGTACCGCCACCTTCCA
TTCGGTATCCCAGCTGAGCTCAGGCGTGTGCAGAAGGAAACCTACGGGTACTTACAGGAAGCTATCTCTGGCTCTTCCAG
TTCGGGCTTGAGAAATATGCCAATGGAGGAGGCAGCCATTAAAGCATCCTGTGTTGGTGACTACCTAGTAAACGCAGTCG
ACGAAGAGGGCAAACACTTTCCCGAAGGCCTTGTTTTAGCCAATATGATGGTCGTCACAGGGGCCGGATTTTCAACTACC
GGCTCTTTGCTGTCTTGGCTTATCTACTGTCTTGTGGCCTACCCCGGGGCGCAAGATCGCCTCCTTCAAGAACTGGTGGA
CCACGATGTCGACGGAAAATTGAATTGGACACCCGACAAGGCAAACGGCATGCCCTATCTCCACAACTTTATCAAGGAAG
GACAGAGGCTGCACAGTCCGTCCTATCAGCCAGGCCGCACGACAAAGACAGATGTGATACTGCCCGGGGGCTATCGTATT
GGTGCTGGAAGTGTGCTTATACCTGCTGTACATGCGATCCATACTAATCCAACGGTATGGCGAGACCCCTTGCTCTTCGA
TGCGGACAGGTGGGACAGCGATGAGATAAAAACTCTTCACCGTTACGCATACATCCCCTTTGCAGCCGGACCTCGTGGTT
GCATTGGGTTTAACTTCGCACTGCTAGAGGCGAAGGTACTCATCTCCGAGCTAGTATATCGATACGAGTTTGTCCGCTAT
GGCAACGAAGCCATTGACTACGATCCCGAGTTCCAGCTAATCCGACCACTGAACCTATACGTCACTGCTCGCAAAAGGAC
GGTCTGGCCGGCCAAGTCCAGAAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62