GenePrediction:GLEAN_6796 Details

Name: GLEAN_6796
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1730064..1728868 (- strand)
Length: 1197
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1730064..1729726 (- strand)
Length: 339
Type: CDS
Source: GLEAN
Position: GCSC_108:1729647..1728868 (- strand)
Length: 780
>GLEAN_6796 class=GenePrediction position=GCSC_108:1730064..1728868 (- strand)
ATGGAGACCATTCCAACTTTCGCCCAAGAGGCGGCCATCCCTGAGGCCCAGCCTGCCATTTTCACGAAGATCGAGGCAGA
GCTGCCCATTCCTAACTTCGATCCCGCGGTGCATCTAAGCTACCGACCGCCACCAGCTCGTTACTCTTTCACGAAACTCG
GCCTTCCTGTACCCAAGGGATGCCCAGACCTGTGCTATACGGAACCCTTCCAGCTTTTCTCTGAAGAAGGTGTGCGGGTG
ATACGTCGAGAGGTTTTCCGTCGGGAGTTTCTGGACAAATACATGCGTTCTTGGGAGAGGGCTCCATGCCTAATCAGCGG
TCACTACCCTGTGAAGAACGTACGTAATTCTGTCTAACAACCTGAGCATGTATTGGAAGCATTCCACCTAGACTGAATCT
AATAAAACATGGCATAGGATGGCACATTTCTTAAGCAAGCGATGACACATCCAGTTACCCAGGCCTCTATCAACTCGGCC
TTTGGATGTGCCCTCAAGCTGCAGTCCGACGAGAATGCTATGGGATACATCAATGTGCAGCTCGGAGCAGATGGCATTGA
TGGTGTCTATCGCTTGGGGGAATACCCAACCAAGCCACTTCCTGTTGCTGCTGCTCTTCCGTCTTCAGATTACGACGGCG
CATTCATTGATAGCTGGCACAAGGATACAACACCAATTGTGCTGGTTCTTATGCTCAGTGACACGTCTACAATGGTCGGG
GGGGAGACCGCCATCCGTACCGGCGACGGACAAGTCATCAAAACGCGAGGTGCTGCAATTGGCGGTGCTGTCATGATGGC
GGGTGCCTATCTGGAGCATGCAGCACTGCGTGCAAGCAACTGTGCTGAGCGGCTTAGTCTTGTCAACAGTTACGCCTATG
CAGACCCCGATGCCGACGACAGCGGAACTACGCTCAGGAGTGTAAACCTGGGCTTTGACAACATCCCCTACGTAAAAAAC
ACTTTCTTGGACTTGAAGTTGCGCCGCCTTAGAGACCGTTGCGATTTGGCTCTAGCACGCGTTCAAGAGCGTCGTGCTGA
GGGCGAGATGCCCAGCCAGGAGGAGTGCGAGGAGTGGATACGCGATCAGATCCGACTACTAAAGCATACCGGTTGGGAAC
TATTTGAACGTATCCCGAACCATCTGGCCAAGGAAATGCCAGAGGATGCTCTGACTAAATATCTTTCTGATGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62