GenePrediction:GLEAN_6798 Details

Name: GLEAN_6798
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1702585..1698001 (- strand)
Length: 4585
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1702585..1702272 (- strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_108:1702093..1698001 (- strand)
Length: 4093
>GLEAN_6798 class=GenePrediction position=GCSC_108:1702585..1698001 (- strand)
ATGTGCACAGACAACAATGTCGACAACGCAATAAGTACGAGGCCAATTCCAGGCTCTTCATCATCAGCCCGGCTTGGCTC
TCCTTCGTCTGTCTCTGTGTCGTCGTCTTCGCCTTTTTCTGCCGCCTTCTTGTCGATGGCCGGTGTTTCCACCACGACGC
CCTTATCATCTCTAGACGGCTGGGAGGCTCGCTCTCCCACCAGCGTTATGGGTCGCACTAGAGCGGATGTCGTGGCCAGC
CATGGAGCCTTGGATGCGAATGTGGAGAGCGGTGCGACGCGTAGCTCGTGCAGCATCGAGGTCGACTCCCATAGGTGTGC
ACCCTGGTGTATTCGCGCAAATGCCCCCTTTCCGTTTACCTCGTTTGCAATGACAAGTCGAGCGAGAATGAACTGTATGA
AGTGCGACGTCGAGATATCTACGTCGTATATTCGTATGGAGCACATACATATACTGGGGTAAGCTAGCTAACGAAAATCG
TCTTGTTTACAGCCTACCTAGAGAAGTGGCCTCTGCGTCTTTCCCTGCCCAATCCCGGCCGCCTGCACAAGTCACCGAAG
CATCGCATAGGGGAGCGGCGGGTCCACAATTCCTCACGAACTCGATACGACAAAACAACCTTCTCGGCTCCAACGACTTC
ATCAATACTGACGCAACCGAATCTTCCACCTGCCCAGCTTCGGTCTCACAGGCATCGCTATCGTCATCGACACACCAGCT
CACATCCTTTAGGACGGCAGAAACCCCATCTAGCTACAAGTGCCTGGTGAGTAAGAATCATCTTGGTCAGGCCGCTTCAT
TCTCGTCAGCGTTGGTGCGACCTAAATTTTTGAAATCGCCGCCGCCGCCACAACAGCCTGCCATTGTGCGTACAACCTCG
TCACACAGAAAACTTGCCCTGCGGCAGCCTGTGCCAGACACAAACGTGCGCTCGGGGGCTTTTGCTGGCAGCATCGCACA
GCTTGAAGCCTCTGCCGAACGCCTCTCCATGACCAGTTCCATTGACGACGCCATTCGGGAAGAGCACCAGGAGCTTAAGC
GCAGCGACAGCAGACGGTCCTCCATTTTATCAGCAAGCATCCGACAGATCGCAGCGCAGACAGCTTCAGACTCGAGTTTT
ACGCTCGTCGATACCTCTTCCTTCCAGTGTCGACCCACTTTTTCCAGACGAAACTCGATCATCGAGCTAAACAGCGCCTT
ACGAACGGCTGTTTGCTTTTCTCCAAGCAATCACAACATGTCCTCAACCTCCTCTGTATCCGGTACTGGCCTACGGCGAC
CGGGGAGCAAAGGAAACAGTATAGATAATGGCAACATATTACCTGCTGCCGGGGAGCAATCAACTGCTGCGAATAGCGGC
CTCCCCTTTATGTCTCGTCACGGGCCGGGGAAGGCTTCGGTTCACAGCAACCGATCTGGTCCACTAGTCCTCCCAGAAAT
CACCGAGACAGATCCGCGGACGACCCTGACTTGGAATGCTTTAGATGACGCCGGCCGTTTGATGGCTTCCGAAAGTAACC
GTGGAGAGGGCGCGACCCATTCGGAAGCCCACGGGCATCCTGTGCCTGATCAAATATCTGTCTCGAACGCTCACGTCAAC
GATTTGACAAACAATCATGAATTCTGGGGGTTGCCAGCCGCAGGAAAAAATGCTCAACACGCAAAGCATAATCCCACGGC
GTTTGAGGACTACCGACCGTATACTTCGGAAACTAACGGGCCATATGGGGGTTCCCACGGTGAAGGTATTCAACAACAGA
GAGGTCGTGAACGGCCAACATCGTCAGCTTCAGTCGGCACATACGATCAGGCAGAAGCGGCCTTTGGTGATTTTGACGGG
GTCCATTGCGACCCGGACGCGGCGAATGACCACCCTGTGCCACGTCAACTTCAGGCCGATGTACCCCCACCACTGCAGCT
GCCGCGCCACTCGCTACCGCCGCGGCCGACTTCATATTTCGATCCCGGAAGTGGTCGCCAGATGTTGTACTATCCTGCGC
GCGTGCCTGCCATGCTATCACTACCTCCCAAACTGTCCAAGAAGCCCAAAGCCGCCGACAGGAACAACAGACGATCTCAA
GTCCTGAGCATGTTTGTTCAGTCAGAGTCAAGCCCTAGAGAAGAACAACATCAGACACATAATTGGCTTCCAGATCCCCT
AGCAGGGGACCTCGGCTCTCCCCTATTGGACACGGAAGAGCTCACCAATGATGCGGCTGTACTGGGCCTGTCAGCCCCAA
CGCAAGCTGCCCGAGCAGCAATTAGAAACTCTGAGTCATTTGTCGAAAGCTCCCCGTTACCAGATGCAGGCACACCTGTG
GTGGGTGACCCAAGAGCCACCGCTGGGCCATTAGGTGGAAGCTCGGCACCGGGACCGAGCAACCTTGGCCGCCCACCTCG
CTTGGTAGACCCCGAGAGACGCAAATCGCGAATGGCAATGTTGAGTTCGCTTCCGCCCCAGTTAAGGGCCTCCGCTTTTT
TCGATTTACCAGCATCTACGGCCGATGTGCAGGTAAAGAACGGATCTGCTATGGACACGCTTGACAGCATACTTGACGCG
GCAGCAAGCGCTCCTGTGAGTGCGTTTACCGATCATGCATTTGCTGGCAGACTAGGCGCGGAAGTATATGGGATGGGAAA
GAAGCGCAACAAACGCAACACTATCACCGTTTCCGGGGCGTCTGGAAGTTCAAGAGAAGGCAAAGGTAAAAACACCCCCT
ATGCGGATCAGAAAGACGACCATGCCAAATCCAAAACTCGCGGCTCGTTCGTATCACTAGTTGGACACATAAGGAAGGTC
AACGAACCTGTGGGCAAAGATGATGATGATCAATCTACCAGGAGCTCAGCCAACAGACGCCACGATATCACAGCCGATGG
CGGTGGAGATGGAGTGCCAAGCCTTGAGAGGGAGGGCACAGCGAGCTTATTAGCGCCTGATGAAGACGAGCAGTCTGCCG
AAGAGGATGCAGATGTGGACCAGGGTGAGAATGGTGAAGATGGAGACGAACTATATGAAGGTGCGCCAACTACTCTGCTT
GCCGAACTTCAGTTGCGTAAACAGCAACAGAAGCTGCGTACGCAGCCCGCATACAAAGCATTCCCCAACGGGATGCACTC
AACTCTTTTGGAGCTAGATGCTGTGGCAGAGATCGAACGGAAAGCTCGAAAGGGTAAAAAGGTGAACTTGGCGTGGGAGG
ACCCATCTATGAATCATGGTGAGGACGATGACGACGACGACGTACCGTTGGGCTTGCTGTTTGCCGCCAAGGCTGCCGGG
CATGGCGACATATCGGCAGTGGTGGCTGAAATAAACCGACCGCTTGGCCTGATTGAGAGAAAGGAGCTTGAAGACAACGA
GCCGCTTAGCAGACGCCGCGACCGGCTGCAAGGCCGCAACCCTGGCGTCAACATGTATCTCGCTAGAGGTGACAATGCCA
TGAAGCGCCAAAATATGCTAGGGCTGACACCGACCATGGCTGCCGTCAATCGGCAGCTTGGTGGTGCTGGTCTACCAGAC
AGGGCAGCGGACATCAGCGATGAGGTGGGCGAGGTTGAGGATGAGCCATTAGCTGCCAGACTGCGCAGAATCAAAGCCAA
AGAGGAAAGTGAACTTCCCAAGGCGCGTCCTGTCAGCACCGCTTTTTCGGCCGAGCTCCTGAGCCATTTCGGCGACCCTG
AGGAAGACGCCAAGGAAAGATTAGAAGGCGGTGAGAAGGGCACGGCCAAAGACAGGGCCAAATTGGAGCTAGCAGAGGAA
GAGGAGACACTGGGTCAACGTCGCCGTCGGCTGCAAGCCGAGAGGGAAGCACGAGAGACGGAGATGTTACTCACCGGCGG
TGCCTTTGATACACCTACCTTCAATAACCAAGCTTTGGACGCCCTAACGGGCACCGACCAGCTTACGCAGCGCATTTCCA
TGGCCAATGTCCTCAGCGCTCACCCACTAGAATCTGCACGTGGGGCGCGAGATCCTCGGGAAGCGGAGCGGCAGCAGAAA
GCAAACTCAGCAGCACGTGCAGCTCGCGAAAAGGAGCAGAGGATGGCAGCAATGCGCGCACAGATGCCCCAAGCAACCCC
CACTACCAGCATCGGTGATGGCTTGTCCAAAACTAGCGGGTTCATAGGCGGGCAATATAACAGCAACGGCGGTGGACTGG
GCATGTCGTCACTGATGCCGCAGACTAGTGGACCTGCTCTTGGCCCCTGGGTAACTTCTGGAGGCATGACTAGGCCAGCG
GGAAATGCTGTGCGTCTGAACTCGCTTGCGGCCGTGAACCACCCAGGCGGCATGGGACTCTATCCCGGCAACATGGACCC
GAGACAGAGCAGCATGGCAACGCGCGCGAACACGATGCACAACGGATATGGATATAGCCATGCTTATGGTGTAGGTCAGA
GCCAGGCCTTAGGTGTGGGCATGGCTGCCGGCCCCTTCTCGGGCGCCGGCTTTGGTGTTGGCTTTGGCACCAATTCTTAC
GCGGGCTATGCTCCCCATTCGCCGTCGATGCCCATGCAGATACCTGTCCCGCCGCCAGGACAGGTAGATCGCGTCGAGCG
ATGGCGGCAGAGTGTGATGCCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62