GenePrediction:GLEAN_6799 Details

Name: GLEAN_6799
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1694749..1691488 (- strand)
Length: 3262
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1694749..1694700 (- strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_108:1694425..1692223 (- strand)
Length: 2203
Type: CDS
Source: GLEAN
Position: GCSC_108:1691838..1691488 (- strand)
Length: 351
>GLEAN_6799 class=GenePrediction position=GCSC_108:1694749..1691488 (- strand)
ATGGCATCTCTTTCCGGTGACCATGCGCCCACCAGCAACGGCGTTAATGGGTAAGTAAGATGTTTAGTGCGATTTGCTCA
TCGTCGCATTTTGTCTTATTATATGACCTCGTTTGTGGGCATTGTTGAGCCTGCGCCCTGATCCCCTACTTTCAATTCAC
TTTGCTGTTATCTGTTGTCGACACCCCCACGTGACACGCGTGCTTACTTTTATCACACTGTCCATTCCATATACTGGCCG
TTCCCTATTGTACACATCGGCCGCCATCACAGCCGTGTTTGCGCGCGCTTTGGAAGTCGTGATCTAACAAGTGGCACTAA
ACAGACGCGTCCATTCGACGTCCACGGAGACAAAAAACGGTCTCGACGATCGCGACAACACTGTCACCACTGATGGGGAG
CCTGAATCCATCGACATCGTGGTCAGCAACGCCAAAAACGCCAGCGCTTTCATTGCGAATGAGGCACTCGAGGAGCGTCA
AGGGAAAAGAACGGAGGAGAACGACAATGAGGTCTCTGACAGGAAGGACGAAGTGAGGAGTTCAAGTGCCAATTCCGGCA
ACGGAGCAGACGCAACATCATCCCAACCGACAGCAACACTTGGAGAGGAACTTGGACCTCTGAAGCAACCGTCTCCAGAG
CGCGTAAGTAACGAATTTGGGGAAATGAAATCGACCAAAGAAGTTGCAAAAGCGCCAGTTGTTGCAGAGTCTACCCCATC
AGCAACAGTGGTGGAGCCAACACAACCAGACGCTGCTGTTTACGCGCCAACGGAGGACGATGTGGAGATGCACGATGACG
CTAGAGAGCCACAGACCACGAGCCTATCATCAGAATTGGGAAAGACCGGAGACGAAGCAGTAGCTGCCGAAGCATTACCC
AATGGCGTTGTGGCACCCCAAGTCGGTACATCTTCTGGTCTTCTTCCTTCTCTTCGAGGCGATACCTCTTATGAGCAGAC
AGCTGCCGGCACTACTTCTGATATGACCATGGGTGACGCACCTTTCAACAAAATAGCGCGTGGGCGTGAAGATGACATGG
AGATTGAGCGTTCGGTAAAGCGCGCCAAGACTGAAGATGCCGAAAGTGCCAACACCTCGACGTCGCAAATTCTCGTCGGG
ACGATGGTTGCGTCGACCAATGAAATGCACATGGACTTGCCAGCCGTTGTCATCCCTCCTCGCAGTCGTGCATCCTCCAG
AGAAGGGAGCCTTTCCGATCCGAAACTCGACAGTTGTGCGATCTCACCCTATGCGAATCGTGAGATTCGTCGTGTGCTTG
CCAGCATTAAGAAGACTAAGGTCGGCAACAATTTCAAAGACCCCGTTTATAAAAAATGGCCATTTTTGTGGGACTCATAT
GTCCAGCGCGTGGCAAAACCAATGGATATTGGCCAGATCGAGCGCAATTTGAGGGAGAGCGTGTACACCAAGCACGGCGA
CTTCATCAATGACTTATTTTTGATATTCGAAAATTCTGTTTCTTTCAACGGCCTTGGCAATATTGTGACTGACGAAGCGA
AATCTTTGGTGGACAACTTTTTCAGCCGTCTGTCAGAAATATCTTCTCGTGAGCCTCAGAAGTCTGACAAAAAGGACTCG
AAGCAGCTTCCAACTCGTCAGACAGGGCCTCGCGCTGCGGCAGGGCGTCGCGAATCAAGAGGTGCAGCTACATCGCCGAT
TGAAGATTCTGTGACGGCTTTTTCGGCAAGTCCGATTGCCGTCACTATGCAAGCTGTCAAGGCATCGCCCAACCCTGTCC
CAATAGCTGGTGCTGCCGAAGTCAATACTCCTGTTTTCGCAGTTCCGGCGTCCGGGATGCCGATCATTCGTCGGGACTCC
ACGAAGGCAGATGGCGATAGGCCTAAACGCCCTATTCATCCACCAAAGAACCGAGACCTGGGATACGAGCCAAAGAATCC
CAAAAAGAAGTTGCCCGAGTTTCGGTTCTGCGAAGAGGTTCTCAAAGAGCTTATGAAACAAAGGCATTACGAGACTAATC
ACTGGTTCTTGCGACCAGTAGATGCAGTCGCGATGCAGATTCCCACTTACCACAAAGTGATAAAGAAGCCAATGGATCTC
GGCACAATGCAGACGAAACTCAACCTCGGCGAATATAACTCCGCCAAGGACTTTGAAAGTGATGTGCAGCTGATTATCAG
AAATTGTCGAAAATTCAACGGCACGGGGGAAGTGGTAAATGCGGCCGACCGCCTGGAAGAACTCTTCAAAGCCAAATGGA
CCGAAAAAGATACTTGGATTGCCGCACATACTTCGCATGGATCAGGATCGGTTCTGAGCCCAGTGGGTGGTCCTAAAGAG
GACGAGTCTGACGAAGATAATGAGGGTAGTGAACCTGAGGGCGACGAGATATCAGGAACGCTTGCTACAAGCGACACGGT
TGATGCTCTAGTCAAGCGACTCGAAGAAGAAAACAGCAGATTGAGCTCTCTCCTGATGGCCAAAATTCCCGACATGACGA
TGATCACTACGCAGCAGACGGTCCTGAACATGATTCAGAAACAGATTGTGGAGGAAAAGACAAAACTGGCAGCTGCTGAA
GCCGATAGGAAGTCTCGGAAACCAACCAAAACAAAAATTGGGAAAAAGGGAAAAAAGCTCCGATCGGTGGAGTTTCTGCA
AAGCGCGCGACATTTAGTGGCATTGGTGGCGCTGCTTCAAGGAAAACTTCTGGTGCATCAGCGAAAAAGGTGCCTAAAGT
GAAGGCATTTGGGCAGGCAGAGAAAAACGTCGTCACTGATGGGATCAACAATTTGGACGTGCAGCAGCTTGAAAGGGCGA
TTGACATCATAAAAAAGGATACCAACCAAGAAGTACGTGTACTGTATCTGTTTAGCATCAAGTATCCTTTTGCTTGGCTA
TTATTTGGGATGTCCGTGCTGACCAAGACAGGAGAGCGAAAGCGGCGAATTGGAGTTGGATATCGACCAACTTTCCCAAG
ATGCGCTTGGGAAGCTTTACGACCTGATCATAAGAGCATTTCCGCACATGAGGGTGAAAACGGAGAAGACTAAATTTGGT
GGAGATCCGTCCTCCGTCGGAAAGCCAAGTAAGCCGAAGAAGCATAAACCTATGGGCAGGTTGGAGCAGGAACGGAATAT
TGAAAAACTCCGTGAAATCAAGGCGCAGTTCCAGCGACCCGGTAGCGGAAGCCAGGAGCCTCTCCCTTCCGTGGAGGTCA
GCCAGCCTATGGGAGAAGCAGAGAGTGAAGAAGAGAGTGAAGCGGACTCTGAGGAGGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62