GenePrediction:GLEAN_67 Details

Name: GLEAN_67
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:441089..442067 (+ strand)
Length: 979
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:441089..441095 (+ strand)
Length: 7
Type: CDS
Source: GLEAN
Position: GCSC_179:441199..442067 (+ strand)
Length: 869
>GLEAN_67 class=GenePrediction position=GCSC_179:441089..442067 (+ strand)
ATGTCCTGTGAGTGAAATCTGTCCTTTGTTGTCCGCCGCCGTCGTCTGCTGTCGTCTACAAGCCATCCTCGGCCACAGCC
CTTCGCCGTCCCCCCCTTCCCCTGAACCAGCTAACGACCAGTCAGTCTTCAACACGACAGCCACGCTCAAGCGCGTCTCG
CGGCTGCCGCCAGCCACGGACCGGGACCGTGCCGTGCGTCTGCTGCTGCATGACCATGACTTTTTCGTGCACTGCGGGCC
GCACAGCGTCGAGTGGGAGGCGGTGCCGGCCGATGAGGAAGCCCGGCTGGCCGAGGCGGCGCTGGACGCTGACGCCCAGG
GGGTGCAACCTCTGTCAGCGGCGGTGCGTGATGCCCGGATGGCCGTGAGGGACGCCTGGGCGGCAGAGGTGGCAGAGGAG
ACAGAGGAGGCAGTGCACGAAGCCGCGGACAAGTGCAGTGCGCCACTGAGCCGCACGTACAACGTGACGGACGTCGTACA
CACGCTGCCGGCCGGGATCTGGGACTCGCGGGTCGTCAGCACCTACGAGATGACCAACCTGGAGGACGGCGTGTTTGTGC
GGGTGCGCTGTCCCTTGTCGATTGTCATGGACACGACCTGGTCGGTGGAGGTGGCAAAGGCGGAGGAGGAGGATCTGGGG
GACGAGCTTGACGTTGAGGCTGAAGCCCAAGACAAGGCTGAGCCCGAGACAAAGGCAGATGAGCAGCCAGGGGCCCTCGA
GCTACACGAGGAGATCGTCATCTACTGCTCACGGCTGCTGATCGGCACGGTCAAGAGTCTGTGCGAGAACGGCTGGCAGG
AGATCCACAAAAGGATGATAGCACGGCTAGACGAGGCCGAGGACGGAGGGGGGAGAGAGAAGGGCCGAAAGGGGGAGAGG
AAGAAGGAGGAGGTGAGTGAGGAGAGCGAGGAGAGCGAGGAGAAGGAGGACAAGGATCAGGGACACGAGGAAGGCATGGA
GGTCAAGGTGGCGGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62