GenePrediction:GLEAN_6802 Details

Name: GLEAN_6802
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1685232..1683697 (- strand)
Length: 1536
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1685232..1685091 (- strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_108:1685006..1683697 (- strand)
Length: 1310
>GLEAN_6802 class=GenePrediction position=GCSC_108:1685232..1683697 (- strand)
ATGCCGCGCTCTCCCTCGTCTTCAGGCCTCCTTTTGTCCCTGCTGGGCTCGCCCGCATCGACGTGGGCCATGTACCGCGC
CTGTATCGGCGCTTTCTTCTCGGGAGCCAATATTTCCGTTGCCGTCTCTTTCTGGCTATTTGGTAGGATGCTCTTGCCGA
CGCAAGCATTGTACTTTTCATTTCGATTGCTAATCTGGAGCGGGGATGGATTGCGAACTGTTCTAGGTCTCATAAATAAC
GTCCTCTACGTCGTCATCCTCTCCGCTGCCCAGGATCTCGTCGGCAATCTCCCTAAGGGCGTCGTCCTCCTCGCTGATGT
CATTCCCTCTTTCGCGACGAAACTAATTGCCCCATACTTCATCCACAGGGTGCCCTATGCCGTACGTGTCCCCATATTTG
TCGCGCTGTCGACTGCCGGCATGCTCCTCATTGCCACTACCCCGCCCGAGGCCTCGGTGGCCGTCAAATTGATCGGTGTC
GGGCTGGCTAGCCTTAGCAGTGGCGGCGGCGAGCTGAGCTTTCTGGGACTTACCCACTACTATGGCCACTTGAGTCTGGC
TGCTTGGGGGAGCGGTACGGGTGCTGCTGGTCTTGTCGGTGCGGGTCTTTACGTCGTGCTGACGGACTGGCTGGGCTTTA
CCGTGCGCTCCAGTCTGCTTGCATCGGCCGTCTTGCCGGCCGTCCTGATGGTGAGCTACTTTGGCGTTCTTCCACAAGAA
CCTCTGCGAAGGGGATCTGCCGCGTCTTTAAAGCATGAGGCCTGCACGACAGCCAAGTATGCTCGCGTATCCGAATTAGA
CACAGTCGGCGAGGACGATACGGAGCAAGTTGTTGTATCTGCGTCTTCGAGCTTTGCAGCACCCGATCTTAGCCCTGGAG
CCACGAGAGCCGACGTCTCTGCTGCGGAGGAGAGTCTGCTGCTGCATCGACCACGGACGGGCCACGGACAACGACATACA
ATTTTTTTTGCAAAGATTCGACGCGCTCGCGCCCTCTTCTTCCCATACATGCTACCCCTGCTCCTCGTTTATGTCGCTGA
ATATACCATCAACCAGGGCGTGTCTCCTACGCTGTTGTTCCCTCTTGACCGAAGCCCATTCGACGAGTATCGTGCCTTTT
ATCCATTCTACGGCTTTCTTTATCAGCTTGGTGTTTTTATCTCCCGCTCGTCTACGCCCTTTTATCGTGTCCACCACCTT
TATATACCAGCAGTCATTCAAGTTGTCAATCTAGTAGTATTGACCGCCCAGGCGCTCTATTTTGACAGCTTCTTACCGTC
GGTCTATCTCGTCTTTTTAATTGTCTTCTGGGAGGGCCTTCTTGGGGGTGCCGTGTATGTAAATACATTTGCCGAGATTA
TGGAGCACGTTCCTATGGAGGATCGCGAATTTAGCTTAGGGGCTACGTCAGTCAGCGACAGTGGCGGCATTTGCATTGCT
GGCTTCATAGGTATGGCCATGGAGGTAGGCCTGTGCAACTGGCAGGTCCAACACGGTCGTAATTGGTGTCATGAATTTGA
GCGAAGCAATGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62