GenePrediction:GLEAN_6804 Details

Name: GLEAN_6804
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1672342..1671354 (- strand)
Length: 989
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1672342..1672296 (- strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_108:1672242..1671965 (- strand)
Length: 278
Type: CDS
Source: GLEAN
Position: GCSC_108:1671574..1671354 (- strand)
Length: 221
>GLEAN_6804 class=GenePrediction position=GCSC_108:1672342..1671354 (- strand)
ATGGCCTCGGCAGTGCTTCGATTAACAGCTCTCAAGGCTCGTGGGCCGTAATCTTGAGGTACCTGCAACTCTCGTACTGA
AACGGGGAGCACGTGATTAGTTTTGGACAGCAACAGAAGAGGGGAAAGGCAACCAGGAAGAAGAGGACACAGGCCAGCGT
AGCAGTCGCAGCCAAGGCCATTGACAGCACGCTGCACAAGCAGCAGTCGGCACGGGAGAAGGCGCTGTATAGTTGGACAG
ACCTGCTTCTGAGGCGCAAGCTGCTCGTCGTATTTCTCACCCTAGCCACCGCACTGATGATCGCCTTCATCGACCAGAAT
GGCATCAGCGTGTCGCTCCTTCCATCTCCCGCGACCTCGACACACAGGACACAATTTCGTGGGCTGGCACCTCTATTATG
CTAGCCAACCGCCGTTGGGCGTGCTTGCTGGCTGCATAACTGTCCATCTGCTGTCGCTCAAGCTGCCTACCTGAACCTTC
GCAGAAGGATCTCGCAAGAACGAAATTTAGGGCATCCTGTCCGGCTCGGCCGCCGTCGTCCTCGTGCTGATCTCAGTCAG
CATGACGGCTCCTACTTTGATGGGACTCCCCCATAGTCATATCTGTGCTGGTCGTCAACGTCTGTCTCACATTTTCATTA
TCGTCGAGCCGAAACTTGTTCGCCTCCCTATGATGCCAAGTGCATCCCCGATCTCTCTGCCGCTACAGCCGACATTCATT
GCCTTGCAGGCAAACACAACCAAAGCACACCGGGCTGTCTTCTTATAGTCCGCAACTTTTTCGAGCTGCAGGTGGTGCTT
TTGGCCTCGCTGCTGCAGCCGCTGTGCTGCAGGCCGGCCTACGGCAGGAATCTGCCCACCGACTACGCGTACCTGGCAAG
CAGTGCGTTCTACTTTCCGTTAAACTTTGCCGACGTAACCGATCGCAAGGATGTTCTTGAAGCCTACATGGCTGCCAGTC
GTATCGATTTCATCCTATTGTACCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62