GenePrediction:GLEAN_6805 Details

Name: GLEAN_6805
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1665724..1663763 (- strand)
Length: 1962
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1665724..1664679 (- strand)
Length: 1046
Type: CDS
Source: GLEAN
Position: GCSC_108:1664423..1663763 (- strand)
Length: 661
>GLEAN_6805 class=GenePrediction position=GCSC_108:1665724..1663763 (- strand)
ATGCTGCACCCTCCCAGTGCATCTCTCTCGAGTACTCCTTTCGCGGCGTCCGTAGCGTCAACATCACATCCGTCCATGGC
AAGCCGGCTGTCTGCCAGCGATTGGAGCTATGATGCGGGCAACCCAGCAGCCGAAACGACGATACCCGGCAGCAGCCAGG
ACGCTTCACTCTATCCCGGATACCACCTACGGGCCCGAAACACAAATCCCGCCACGATCTCTCCAGGCTTGGATGGCGTC
GGCTTGGACCCGATGCAATATCTTCGATCGCGAGGCTGCGGAAAGTTGCTGCCAAACTCTTCCCCTCAGCAGTACCTTTC
TCCCCCAGTCGAGATACACTTTCATGCCATGCCTTCTTCAGCCCTTCCTTCTAACTGTGGCTCGCTCACGGAAGATACTG
GCACGGACACAGCTACCAGCTCAAGAGTGAGTGAGAGCTACCAAGGCAGCGTTTTTGGAGCGCTCGATATGGTACAGGTC
AATTCACAGGACTCTTTTTCCGAATCTCCGCTTGTCAGCCAGGATATCAAATTGCCCCGCCGTAACTACGATGATCTTGC
TATCGTTGAGCAGCCTCTCGATAGCGATGTGGCTGTTCTTGGCATCGGAACTGGGTATTCGTTGGCGGCACAATTTTCTC
AATCAAGTTCTGGCCAGTCAGCTTCCCATTTTCCCGGGAATTTTTTCTTTGCGATGGAACCAGCACTTTCTCTCGACGGC
ACAAGTTACTGTCTCAATACCACAGATGGGGAACCTGAGCCTGGTTCTGATGGTGCCGAGCCACGGCCACAGCATCACTT
TACCGATATGGAACGCTCTGAGTCCAATGGTAGCACCCGCTCGACCTCATCTTATTTAAGTGCTCGCGCAAAGGACACAT
TGCGACGCCAAAACAGTGCAGCAAGAAGATTCGCCATACAACCAAGGGCCTCTGCGTCTGCACCTGAGTCTACAATTTTG
CGATCCCAAAATGCATTGGAGGATGGCCCTGAGCCTTCTAATAGAGACGCGGCCGCGCTTGGCAAAAAGGAAATTCTCAA
AGCGAGGTATGCGCGGCCAAAGCACCCGAAGTTGAAATGCCTCCGCTGCAATACCTACCCGGAAGGCTTTCGTGGTGAGC
ATGAGCTTCGACGGCATATGTATGCCAAGCACACGCCTGACGTCAAAAAATGGGTTTGCTGTGACCCTCACGCATCGGGT
ATCAAGACAAACGTTGAAGTCATCCTCCCCCTTCTTGATTGCAAACATTGCAGTGCTAAGAAGTTGTACGGAGCATACTA
TAATGCGGCTGCTCACCTCAGACGCACGCATTTCAAAAAGAAGGTGCCAAGGAAGGGAAGTCACCAAGCGTCGCCAACAG
CTTCTTCTGCAGCAGAGGATGAGGCAAATACTGACTGGCCGCCCATGCCGGATCTGAAATGCTGGATGAAAGAGGTTATC
GTACCTGTTGGCATTACCGATGCCATAGCTGAAACGGATGGCGGGGAAAAGGACGAGTCTACCAGCCCGCGTCCCAAGAA
TCGTTCCAGGACTGTTATGCCCTCTTTTGCAGGCTCTACATTGCCCATAAAGCTGGAAGAGCAGGCAGAGTCCTTCGGCC
TCGGGAACGAACTTCCGAATATTAAAGGGACCCGTGCTGTTGTTGATGGCAACACAACTTCTGGATCATCGTCTGATTTG
CAGAACGAGATGACTGCCGAAGAGATGGGGCCCGCTTTCGACCACGGACTGCTTTCCTCTGCGACTTTCTTGGAGTTGCA
TCAACCCTATTCCAATTTTGCACAATTTAGCCACACCTTCGTTGGAAGCCTATCCGAGGCGACCGAAATGACTTCCGTGC
CGTCAACTCTTTACCACAACTGTAAAATTCTTGGCAACGACTTTGATGAGTTCAACTACAGCAAAGACTCTCCACACTTC
GACTTCATGCCATATAATTCTGACAGCAATGCGTTTTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62