GenePrediction:GLEAN_6808 Details

Name: GLEAN_6808
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1645158..1642003 (- strand)
Length: 3156
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1645158..1644634 (- strand)
Length: 525
Type: CDS
Source: GLEAN
Position: GCSC_108:1644555..1643524 (- strand)
Length: 1032
Type: CDS
Source: GLEAN
Position: GCSC_108:1643295..1642003 (- strand)
Length: 1293
>GLEAN_6808 class=GenePrediction position=GCSC_108:1645158..1642003 (- strand)
ATGGAGGCTACTTCACCCACGTCACTCTCCCCTCCGCGGGCCTACCACTATCCGTACTCTCGTACACGCGCTTCGTCACG
GTCTAGCCCATTTATCGCATCTGATGGTCGAATGGCGGCTTCAAACTTGGATCGGCGTCCATCAAACCTCACACCCTCGC
CACAACCAAATTTGCAACAGCAAGAGCAGCTAGAGCCCGCTTCATACCTCACCCACCGATTTCAGAGTTCTATCAGCTCC
CGGCCCGCTCCTTATCCGTTCAATACCGGATCTCCACGGCTACGGCCTCCTCGTGAGCTGAGTGAAGAACCCAAGCTCTT
TGCCACTTCTTCATACCTCCAGGAGAGGTTGTTGCGAGAGAGAAAGGTGGAGAGTGAACGGTCTGCCAGCAGGATGAGTG
GCGATAGAACTTCTTCTATTGACCTTGGGTCCTCCCAAGGTTCTCCGGCGCGTTCTCGGTCTATTACAGGCAACGGAGAG
TCTGTCAAGAAGAAAGGAGGTGTCGGCCTGAAGGAGATGGAACAGGTAGGCGCACCATATTGCCAAAGCCCCTCACTCTT
CAAAGCTTGTGTCCGTCTGACAGCAGAATTTGCTTTCCACTAGACTCTAACCACCCTCCACAAACAAAACTTTGATCTCA
AGCTCGAACTCTTCCACCGGAGGGAAAAACAAAGCAGGCTGGAGGAAAAGTGCGAGAGCCTCGACCGCGAGAAGCGAGAA
GCAGAGGAGATGAACGACAAGCTTCTCACCGAAGTGGAAATGAGGGACAAGGCCGTAGAGGAGGCTGTTGGCATGATTAT
CGCCCTTGAAGCTCGGCTTGAGCAGCTCTTGCGCGAGCGGGAGATGGTCCACCAGGTCGAAAAGCACAATTTATTTGTGT
CCAATCCAAGTGTTCGGCGTGCATTGTCTTCTGCTTCTCGCTATGTTGCAGCAGACTTATCAGCGCCTTCAGACCATCCC
TCGAGACCGAAACACAAGCCTGACGAAGGACGCACTCTAAATAGGATGCCAAGCTTTTTGTCTGAGCGGAGCGAATACAC
GGAAAACCTGCGCAACGTGTATCTGGGCAGTCTGATCAGCCTACCGCGCATGTCAGAGGACAACACGGAAGGTGACTTTT
TGGATGTTGCTGATCGCGTTGGAAGTCCTAGTCTCAGTGTATTGAGCGAGAGCTCCTTCCTCAGCATCTACGGCAAGGAA
AATGAGCCCCGGATGTCTTCCTTCGCAGCATCTATGCAACAATCAATGTCCAGTGTCCCTGCCGATATTCCGAGAAATTC
TTCGACGCCGTCTCACCATGCGTCTACCCCCGTCGCTGCAACACATACACCACTGGCCACAATGCCGTATCCAGACGCTG
TATCGGAGACAACACTAAGAAAGCAGCGGTCGAGCTCGAGGGCGCGAACATCTAATGGCGCAGCGGGGCTGAGCTCGCAA
ACGGATTACATTGGTACGAACTCTCCTCTGCAGCGCCTTGAGAAGATGGAATTGTCGCTACAGGCTATGGATGACGCGTC
CCAGCCCAGTAGCGATGAGGGTCTTGAACAGAAACCCGAGTCTCTTACGCATCAGCTCCGTGCGCGAGACTTCGGCAAGT
CAACATCTGGGGGAAAGCGAGATCATCTTCGCAGGGTGCGTACAGATGCGTCATTTGCAGGTGCAGGGAACCCGCATAAC
CTACCACCTACCCCTGACACAATCTCGACGTCGACCCTCCGGAGGTACAAAAACTCGAGCGATACTTTGTCTCAAGAGAG
AAGCAGAATCAGTAATGAGACAGGTTATGTCTCTCTCTCCGGGCATACCACATCGAGGCGTGCCAGTGAGGGTGCACGGT
ATATCGCGGATTTCTCCGAGCAGCAAATAGCGGCACCACAGCCGTCATCGACTTCGGCTTTCAATAGCCGACGCTTCGAA
ACTTGTGTGCACAATGGCTACTTTGACGACCGCCTTCAAGTTCCGCCCCGTCCTCGGTCCACTGATGAAAGCACGCTGTC
GCATTACGGTCGAGGGAGCGTCTGGGGAGACTCGGAAAGCTCAGACGACGACATGGATATCGATGGCAACGACTCTGCGT
CGATGCAGGACTGTTGGCTCCGCGAGAGTCTGCGGCCTGCAGGCCTGGCTCCTCGCACGCGGAGAGGTGGGAAGGTGTCA
CCGGATCTCTTTCACTTCCCATCGACGGTGAACGGCTGGTCGACAAACGAGATGTTTGGAAAGAGTGGACAGGGTTACCC
GGGGCCTGCTGCAGATGGCGCTGCGCCTAGTTCAAACACCCTCGATAAGCTGGGCGACTCTCTACCGGCGCCAGTGAGCG
GGCTATTTGGTGCCGGGGGCTTGCTTGCTTCACCGCTGCCATATGACGTGGGCTCCATCCCCGGCGGACCGCCACCGCCG
CCAAATCGGCGTTCGAGTCTGCATGCACAGACAGGCTCGTTGCGGGATATTAACTCAAGATGTGCATCTCAAGCAGGATC
CACAGGCCCTGGCACTCCGAGCACAAGCGTATCAAATACGAGGACACGACGGTCTCCGGTGCGAGTCTCCATTGCGGGAG
GTGCAAGCGCGAGCCTGTGCGCTGCTACTGAAGACAGTGCCCCAGAAAAGAAGGCACAATCTCTAGCTGTCGGGCAGCTG
GGGGAGCAGATGGTGTTGGCGAAAATGCGGCACTACCCTCCCACATCAGGGTTGACGCCGCGGAACCGGGTTCTCAGCCT
GTTTCGCCGATCCGGGTCGCATGAGCTGACACCAGCATTGGCACCAGCATCGGCACCAGCAACGGCGACAACATTTTCGT
TGGCACCGGGGATAGGTGTGCCATCGAGGATGCGAAAGGGGGAGATTGACGGCGAAGGCGGCCGGAGCAGCGCCACACCT
CCGCCAATCTTACGCAACGGGCGAGGAGGAGCCTCAAGCAACTCAGAGGTAGTTTCTGGACAGGCCGGGAACAGCGGTGC
AGCCCTGAAGGCGCCAGAAATGGTACTTGGGGCAAACGAGGAGGTGCAGACGGTGCAGATACCAGCCATTACACAGGCAC
CGGCACAAGAGCCGCAGGTAGTGCAGGACGATGCAAATGCTTCAGTCGGTACAACTCCGCGCAAGAAGTGGTTGGGCCTC
GGACGTGTGGCAAACCTGCGTGCACGTGTGGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62