GenePrediction:GLEAN_6810 Details

Name: GLEAN_6810
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1629398..1626049 (- strand)
Length: 3350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1629398..1629180 (- strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_108:1629124..1628992 (- strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_108:1628908..1628785 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_108:1628717..1628577 (- strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_108:1628480..1628291 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_108:1628226..1627822 (- strand)
Length: 405
Type: CDS
Source: GLEAN
Position: GCSC_108:1627380..1626049 (- strand)
Length: 1332
>GLEAN_6810 class=GenePrediction position=GCSC_108:1629398..1626049 (- strand)
ATGCTTCGCAACATGGCTGATACGATCGACCTTACCCTGGCCATCAAGCCTACCGATATGGAATCTGTGCCGCAGCGGAT
CAAAGACATCAATGTGTTGAGTAAAGACTTGATTGGGTGTAGCCAGGAAACTCGCCATCAGCTCATAGTCAAAGCCCGCA
ACCTCATGCAGGCACTTCTTACACCTCGCGAACAGATGGTGCAGCACATTTGGGCCAATGTAAATCTTCTCCAAACTTTT
ACTCTGTTAGGTTGTTTTGACTTTTGATGATTAGTCCGGACTGAACGCCGCCCTGATTACGGGAGTAGACATTGGGCTTT
GGAAACTCATGGTGGCCAATGGTGTGAATACGCCTCAGAGGGTTGAAGATCTTGCCAAGCCGCTAGGGATAGATCCCGTG
CTTCTCGGTCCGTGCTTGTGTCTTATGAACTAAGAACCGATTCATTTGTCGTCGAAGGCTAGGCTAACATTCCTGCGCTG
TAATGCACAGGCCGTTTGATGCGCCATGTTTGTGCCATGGGCCACTTGGAGGAAACGGCGCAAGACGAGTACAGGCCTAG
CAATTTTTCCAAGGCGCTGAGCCTGGACGTCATCGGCGACGGCTATGTTTCTGTGTAAGTAAAGCCTGCGATAAAGAAGA
AGCCCCCACTCGCAACGGCTGGCTAACGTCTTCTGCTGCAGCCTCGGCGGAATCGGCCGCAGCCACATCGAGTTTAACAA
GTTTCTACGCGAAACACAATGGCGGAACCCAATTGATGCTGCCCACACGGCCATGCATGCCTCCTATAAAACTGACCTGC
CAAACTGCTTCGAGTACCTGCGGTCGGTCGGCCTCGGCCCCCATACAAATCATCACAGTTCGTGCAACGAGTAGAGGGTA
GAGTTGAGAGGCCGTGTAACTGACTCCATCTTCTGTAGTGGGTGGCTACCGGCAAGGTCGGCTGCCGTGGGTGCATCCGC
GTGGATGCATCCGTCGCTCTACCCGGTTGAGAAGCCGCTGTTCGTCGGCGCGGATACCTCTCCAGATGCGCCGTTGGTTG
TAGACGTGGCTGGCGGCCTAGGCCACGATATCAACGCTTTCAAGAAGCTCTACCCGAGCCACCCTGGTGTAAGCAGGCCC
GGATTACTCCTGCCCTGAAAAAACATCCCGATTTCTGACAACTTTTCCACAGAAATTGATCCTTCAAGATCTACCAGTCG
TGATCAGTGACGTCAAGGATATCGACTCCTCGATTCAGCTTATGGGCCACGACTTCTTGGCAGAGCAGCCTGTCAAGGGC
GCTCGGGCCTACTTCATGCACTCCATAATGCATGACTGGCCAGATGACATGTGCCAAAAGATCCTGGCACGTTTGGCGGA
CGCTATGAAGCCGGGCTACAGCAAGTTGCTGATCTTTGACTGCGTGATACCACGAACAGGCGCGTATTGGGAGGCTACAG
CGGGTGATATCCTTATGATGACACAGCTATCGGCACTGGAACGCACGGAGGACAACTGGCACCAGATGATTGAGGGGAAC
GGTAGCAAGCTGAAGATTGTCAAGTTTTGGAAATGCGGGCAGTCTGACGTAGAGAACGTGATCGAGTGCGATCTGGCTTA
GGGATTGCTTAGATTTCGGGTTGACAGGATCGTGGACGCTATATATATTACAGTGCGTGCCCACAGTCAGAAAGAGAAGG
TGGCTTTGGTACCTGCTAGCTCAACGACCAAGAATACACAGGCCACGTGTCAGAGGTCTTCTCCCATGTGTCCATTTAAA
TAAGAGAAACTGGAAAGCGCACCCTCAGAACTATGACTCGTAGTAGCCCAAGCTGGCTAGGCGTCATGCAATCTGCCTTG
GCGCTCTTGGCAGGTGCCAATCCTCGCTTACCCCGTAAGCCTCAGGCCGATACGAAATACGATGCCATGCATCCATAATT
GTGTGTTGTGGCATCTTGTCCACCCGCCTGGCCGAGCAGGCATTTTCAACCTAGACAAAGAAGGCCTCCTTGCTGCTGCT
TGCTTTGAAATGGAACAGACACTTGTGACACTCGGTGCAAAGAGTCGAGACCGCCTCCTCTCGGACACTCTGGACGGCAT
CCGTCACCGTCAGGCAGAGGCCCCTGCTATTCTGGCTAGACTGCGCCAGCTCAATGCAGAGCTTGCCGACCACTTTCACG
CCAAGCAGAATGCCCTGTCCGGCCTGACGCTGTGCATGCTCTGTCCTCAGAGGCCGACAACCTACACGGTGCCATCGTTT
ATCGCCATCAGCTACTGCTGGCACTATGCGGACTGGCCGCTCGCTCCGGCTGCCCAGCCGATCTATCCGTCATGGGAGAT
TTCCAAGCCCATGGTGGATGCCATAATGGGTATGCCTAATATTCGGGAAAGCCCAGATGAGGGTGTGTGGCTGGACAAGC
TGTGCATTAACCAGTCAGACGAGGATGAGAAGATGGTCGCCATCGGAGCCATGGACGTTATCTACAGCTCAGCGCGCCGC
ATCGTCATCCTTCTCGAGAACGTGCAGCTGGAGGCGGATGAGGAGGCAGCTGGACTGGCCTACGCTGGCTTCTACGCCGA
CATGTGCGCCGAGGTGAAGACTCGCGAACTTGAGGGAGACGAGAAGAGAGACTTCGTCGCAGGTTGCTTCCCCGCCCGTA
TTGCCGCTCTGCCAGCTGATGAGAGGACGCGTATCACGGACGCATCTGTGCCGTTTGCAAATCGTCTACTCAGCGCTCGA
TGGTTTTCCCGAGCCTGGTGTGCTCACGAGAGCCGTGTGGTGACTCATGGAAAGACGGACAACCCACTCTTTCTCTGTTT
TGGCAGCAATTGCCTGGTCCTTGCTTTCCAGTTTCGCTTCGTCCATTACTTCTCTCTCTGCCTGTTGGACTCAGACCCCG
ACCCTCCGGTTGCGTCGGAGGAGTACTTTGGCTTCCTGAATGACCCGAATTTACAGACGCTTCGTCAGCGCTGGTCTCGG
ATCCACCGTCTCCTGGGCAGGCCTGGCGCAGCAAATGTTGCACCCACGCAACACATGGTCAGCCTCATACCGTTTGGCTG
CCTCAATGCTTGTGACTTGGTGTCAATTGCACTCAATACAGCTGGAATTCCTCTCACATATAGCGGCAATATAACCGACA
AGGGCGACTTTGTCTGGATATTCTCTGCTATCGCTATTGCAGTCGGCGATGTCGTGCCGCTTCTACTGATCGGAAAGAAG
CTGCGGATTCTAGACCATGTTGGGGAGGGAACGATGACAGTTTCCTGGGTGACCGACCCGATCAGCGGTGTTGTTGACGA
TAGACAGCCAAGCGGTCTTACTAATTCCATCACCGCGGTGACCAGAGAGTACATCGAACTAGACTGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62