GenePrediction:GLEAN_6812 Details

Name: GLEAN_6812
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1607548..1605930 (- strand)
Length: 1619
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1607548..1607432 (- strand)
Length: 117
Type: CDS
Source: GLEAN
Position: GCSC_108:1607111..1605930 (- strand)
Length: 1182
>GLEAN_6812 class=GenePrediction position=GCSC_108:1607548..1605930 (- strand)
ATGTTAACCACCCTGAGATTGACGGCGCGCCAGACGGCAGTCCGTCGGAGCTTTGCCGCCTTCACTCTCGTTGGCCGGCC
CTCGTCAACCTGGGCCAATGTGCCCCAGGGCCCTCCGGTATGTGTTGTGTGTGTGTCCTGACGAGCTGGGTGAAGGGAAG
GACTATGATGTGGGGGCGGGGAGAGACGAGACGGACGAAGGGAGAGCAGTGGGAAGAGGAGATGCGATGGAACAGAAGGA
GCGAAACAAGTGCAGACACGTCGAACTGATACTGACCTTATCTCTTGCAGGACGTGAGTAGCAATCTGCTCCTGCTGCCT
TGCTGTGCTAACCCAAGACGACGTCTCGCCGGCTGATAGGCTATTCTTGGTAAGCTGCGATAACGAGATGCTGAGCTGCA
TCTCCACAGAAAGAGTGATGCTGCAGCCCCCACACAGACGCTAACGAACAGCACAGGCATCACGGAGGCTTTCAAGGCCG
ACTCGTTCCCGCAGAAGATCAACCTCGGTGTAGGCGCCTACCGCGACGATGGAGGCAAGCCGTACGTTCTGCCGTCGGTG
CGCGAGGCCGAGGACGCAGTGGTGGCGCAGCGGCTGAACAAGGAGTACGCGGGCATCACGGGGCTGCCGGAGTTCACCAA
GGGCGCGGCCGAGCTGGCGTACGGAGCCGGCAACCCGGTGCTGGGCCGGCTGGCAGTGACACAGTCGATCTCGGGAACGG
GAGCTCTGCGCATTGGCGCCGCCTTTGTCGAGCGGTTCTACCCAGGGCCTGCCGGCGCGGCGAAGAACATCTACATCCCG
GCGCCGTCGTGGGCGAACCACGCGGCCGTGTTTAAGGACGCCGGCCTGACGGTGCAAAAGTACCGCTACTACAACCCGGA
CACGATCGGCCTGGATTTTGAGGGTCTTCTGGCAGACGTGCGGGCGGCTCCGAGCGGCTCCGTCTTCCTCTTCCACGCCT
GTGCGCACAACCCGACCGGTGTCGATCCGACCGAGGCGCAGTGGAAGGAGATCGAGGCGGCGGTGCGCGAGAGCGGCCAC
ACCGTCTTCTTCGATATGGCGTACCAGGGCTTTGCCAGCGGCGATGCCGACCGCGACGCCTTTGCGGTGCGCTACTTTGT
CGAGAAGGGCCACGAGCTCGTGCTGGCGCAGTCGTTTGCCAAGAACATGGGCCTCTACGGCGAGCGTGTCGGCGCCTTCA
GCGTCGTCTGCTCCGACGCGGCCGAGGTTAAGCGCGTCGACAGCCAGATCAAGATCCTCGTGCGGCCTCTGTACTCGAAC
CCTCCCGTTCATGGCGCCCGCGTGGCTGCCGCGATCCTCGCATCGCCCACCCTTCGTGCCCAGTGGCTCGCCGAGGTCAA
GGGCATGGCCGACCGCATCATTGCCATGCGCTCGCTGCTGCGCCAGAACCTCGAGACGCTCGGGTCCAAGCACGACTGGT
CGCACATCACCAGCCAGATCGGCATGTTCGCCTACACCGGCCTCACGCCCGAGCAGATGGACCTCCTGGCCAAGGAGCAC
TCTGTCTACGCCACTCGTGATGGCCGCATCTCGGTTGCCGGCATCACCAGCGAAAACGTCGGCCGTCTGGCCGAAGCCAT
CTTCAAGGTCAAGGGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62