GenePrediction:GLEAN_6814 Details

Name: GLEAN_6814
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1595581..1593038 (- strand)
Length: 2544
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1595581..1595511 (- strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_108:1595435..1595210 (- strand)
Length: 226
Type: CDS
Source: GLEAN
Position: GCSC_108:1595144..1595026 (- strand)
Length: 119
Type: CDS
Source: GLEAN
Position: GCSC_108:1594942..1594895 (- strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_108:1594835..1594709 (- strand)
Length: 127
Type: CDS
Source: GLEAN
Position: GCSC_108:1594636..1593993 (- strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_108:1593919..1593430 (- strand)
Length: 490
Type: CDS
Source: GLEAN
Position: GCSC_108:1593366..1593230 (- strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_108:1593176..1593038 (- strand)
Length: 139
>GLEAN_6814 class=GenePrediction position=GCSC_108:1595581..1593038 (- strand)
ATGACTTTGCCGGAGGAGTTTGATATTATCGTTTGTGGAGGTGGCAGCACTGGCTGCGTCGTTGCTGGCCGGTAGGCAGA
CCTTATATGTGCAGGGCAGATGCCGAAGCTTGTCCGAATGCGGCTGGCTGACAACCGGCTTTACAGGTTGGCCAATCTGG
ACCACAACATCTCGGTGCTGCTGATTGAGGCGGGCGAGAGCAACCTCAACAACCCATGGGTCTTCCGGCCGGGTGTGTAC
CCGCGCAACATGAAGGTGGATTCCAAGACGGCCTCGTTCTACGAGTCTCGCCCGTCCAAGTGGCTTGCTGGCCGGAAGGC
TGTTGTGCCCTGCGCCAACATTCTTGGCGGTGGCTCGTCCATCAACTTTCTGGTAGGCCCCCTCTTTGTTTGCCTCTCCC
TCTCCGAAGGCCGAGTGACGATGCTGATGCCGAACAGATGTACACACGGGCTTCGGCATCTGACTATGACGACTTCCAGG
CCAAGGGCTGGACCACCAAGGAACTTCTCCCGCTCATGAAGAAGAATGAGACGTACCAGAGGGCGTGCCATAACAAGTGA
GTCCTTTTCTTGTGCAGCCGTGCCGGGTCATCCACAAGTCATCAGAGCCAAGCCTTGTACTAACATCACACTTTCCCAGG
GACGTTCATGGCTTTGAGGGTCCCATCAAGGTGTCCTTTGGAAACTAGTAAGTTCCTCTTTCTCGGTCTCTCTCAGCCTC
TTCGGCATCCTGACCGTTTCCCTCAGCACCTATCCGATCAAGGATGACTTCCTTCGTGCAACCGAGACTCAGGGCATCCC
TTTCACCGACGACCTTGAGGATCTGAGCACAGGCCATGGAGCCGAGCACTGGCTCAAGTGGATCAACCGGGATGTGAGTC
CTCCCTTTCTCTTTTCCTCCCCCTTTCCTCTTTCGTCCCACAATCCCTCTTACTAATCGTCGCAGACTGGCCGCCGCAGC
GACAGTGCCCACGCCTACGTCCACTCGACCCGGGCCAAGCACTCGAACCTGTATCTTGCCTGCAACACCAAGGTCGACAA
GGTCATCATCGAGAATGGCCGTGCCGTCGCTGTCCAGACGGTTCCGACCAAGGCTGTCAACCCCAACGAAGTGGCCACGC
GCACCTTTAGGGCCCGCAAGCAGATCGTTGTCTCTGGTGGCACGCTTTCGTCGCCGCTGATCCTGCAGCGCTCCGGTGTT
GGTGACCCCAAGAAGCTGCGCGAGGCTGGCATCGAGCCCATTGTCGACCTTCCGGGTGTCGGTCTTAACTTCCAGGACCA
CTACCTCACCTTCTCCGTCTTTCGGGCCAAGCCGGGCACCGAAAGCTTCGATGACTTTGCCCGCGGCGTCCCCGAGGTCC
AGAAGAGCGTCTTTGACGAGTGGAATCTCAAGGGCACCGGCCCGCTGGCCACAAACGGCATCGATGCCGGCGTCAAGATC
CGCCCGACAGCCGAGGAGCTTCGTCAGTTCACCTCGTGGCCCACGCCGCACTTCAACAGCGGCTGGGAGACATATTTCAA
GAACAAGCCTGACAAACCGGTCATGCACTACTCTATCATTGCTGGCTGGTTCGGTGACCACACACTGATGTGAGTTTTCA
GGCATCCTCCTCTCTCTCTCTCTCTCTCTCTGCCTCGTCCCCTTCTTTCTCTAACATCACAGGCCCCCTGGAAACTTCTT
CACCATGTTCCACTTCCTCGAGTACCCCTTCTCGCGCGGCTTCATCCACGCCAAGTCAGCCAACCCGTACGAAGCGCCTG
ACTTTGACACCGGCTTCATGAACGACGAGCGCGATATGGCCCCTATGGTCTGGGGCTACATCAAGTCGCGCGAGACCGCC
CGCCGGATGGACGCCTATGCCGGCGAGGTCCAGAACATGCACCCCTTCTTCGAGTACGACTCGCCCGCCCGCACTCACGA
CATGGACCTCGAGACCACCAAACAAATCGCCCTGGCTGGAAACCTCAGCGCCGGCCTCCAGCACGGCTCCTGGAGCATCT
TCCTGCCCGAGCATGACCGCAAAGCCGAGCCCAACATTCTCAGCAGCAACAAGGTCAACCACCGCCATGACCTCAAGTAC
TCCACTGAGGACATCAAGGCCGTCGAGGAATGGGTCAAGAGACACGTCGAGAGCACATGGCACTGCCTAGGAGTGAGTTC
TTTGCGCCTTGTTCTCCCTCTTCTCCTTTCGTCTCGCCTCCTTCTAACAACACAGACCTGCTCCATGGCTCCTCGCGAGG
GCAACAGCATCGTCAAGCACGGCGTGCTCGACGACCGCCTGAACGTCCACGGCGTCAAGGGCCTCAAAGTCGCCGATCTC
AGCATCTGCCCCGACAATGTCGGCTGCAACACGTGAGTACCAGAACCCGTCGCGAACCTCGCACAATACTGACAAATTCT
CGTAGGTACTCCACCGCCCTTCTTATTGGCGAGAAGGCCGCTATGCTTGTCGCTGAGGACCTCGGCTACTCCGGTCCGGC
TTTGGACATGAAGGTCCCCGACTACTATGCGCCCGGCGAGAACCGCCTTGACCACCGCCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62