GenePrediction:GLEAN_6815 Details

Name: GLEAN_6815
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1573981..1570164 (- strand)
Length: 3818
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1573981..1573702 (- strand)
Length: 280
Type: CDS
Source: GLEAN
Position: GCSC_108:1573629..1572713 (- strand)
Length: 917
Type: CDS
Source: GLEAN
Position: GCSC_108:1571972..1570336 (- strand)
Length: 1637
Type: CDS
Source: GLEAN
Position: GCSC_108:1570281..1570164 (- strand)
Length: 118
>GLEAN_6815 class=GenePrediction position=GCSC_108:1573981..1570164 (- strand)
ATGAGCTGCCCCGTTCGCAGGCTGTCGCTACAGCCGAGATTTTTGGCCGAGCAGGCTTCGGACCGCCAGCCAGTGTGGGC
ATTGCTGCCGGCCAGGCGACTGATAGGGTCTACAGGCACGAGAGGACGCCCGAATCCGTCTGGCAACGATGGCAACGGCC
AGGCGGCCAGAAAACGGCAGCAGGAGGTGCGCCGGTCATGGAGTCGAGAAGGGAGAGACCGTTCAGCCACTGTCAGGCCG
TCGTCAGCGAGCAAAGAGGTAGTGGTAGCAGCCCAGAAAGGTCGGTAGAGTGGCCATTAGCCGTTGCTAGAGAAGCGAGA
GGCTGACTAGTGGGAATGTCCCATTCTCGCAGGAAAGCTATTGACGACACCCACACGGCTTCTCAAGTTCGTTCTCCCAC
TGCCGCTAGGCTGGCAGAAGGACACGGCTGTAGATGGACCGGACATGCGCATGGAGCCGTTGGCACTGCTAGTGCACCCG
CAACAGCCGATGTCCTACGTGGAGCGGCTGATCCTGGCAGAATTGCCGGGCGAGGACGCGACCAACGTGTATTTCCGGGC
CGAGAACACGCCAGACGAGGAGGGCCAGAGCAAGGACGGGGGAGGTTCGCACGTGGCGTGGTACTCGGGGCTGGGCCACG
AGGCGGCCGAACGACGGGATCCAGACAAGAAGTGGGTGCGATGGAGCAGCAGCACAGAGATTGGCGACTTCATCCGGGAG
GCGGCACGAGGACGCGAGTTTGCGATTGAGATCGAGGGGCCGTCAACGGTCGAGGTGCGGGTCAGCGTGCCCTCGTTCAG
CGACCGGACGTACTACCAGCGGATGCGGTTGCGGCGGCTGTCGCGAGCGGTGGAGCGGCTGTCGACCGTGAAGCGGGAGT
GTGACGAGCTGGCACATCGGGGGGCAAGGCGGCTGGCCAAAGGGGGCTTTGCCACGCTGATGGGCTGGTGGGCGGTGGTG
TATTACACGACGTACCAGACGGCGTATGGCTGGTCGGTGATCGAGCCGGTGACGTACCTGGCCGGGCTGGGCGTGATCAT
GGGCGGCTATCTCTGGTTTCTCTTCATCAGTCGTGACCTGAGCTATCGGGCTGCGATGAACGTGACGGTGCTGCGGCGAC
AGGCGGCGCTGTACGAGAGTCGTGGCTTTGATGTACGGCGGTGGGACCGGCTGGTGGAGGAGACAAACGGTCTGCGAGCC
GAGATCCGGCGGGCAGCAGCTGATTATGATATCGAGTGGGACGAGGAGGCCGATCTGGGTGGAGGGAAGGTGAAGGAGGT
CTTGGAGAAAGAGAAGCGGAAGAAGAAGGAGAAGGAGAAGGAGGGCGAGGACGAGGATGAGGATGAGGAGGGCGAGGAGA
AAGAAGGCGAGGAGAAAGAAGACGAGGAGAAGGATGGGGAGAAGGAGACGGGAGGTGACAAGGGAAAGGAGTAGAGGAGG
TAGGAGAGAAGAGGAGAAGGCGGAGAGAAGGGGAGGACTATGGGGGAGAGAAAGCACGCGGGAGGGCTAGTACGATGGGC
AGGAGAACAGACGAGCAGGAGTAGGAGCAGACGCACATAGAATAAGGTAGAACGAGATCAGACATGAGGATAGCTGTCCT
GAGACAAGATGCCGATAGATTCAGACGCAAGCATGATTACATAAGCATTGACTTACGATGTTTTTGAACGGCAGGCGCAG
TGTGGCGTAGATCGTGACACACGCGTGATGGCAGCACGTGAAGGCAGTCGCCAAACGCGTGAGGATCGTATTCACGTGCA
GCAGGCTGGACGTGCCTGCAACCCCTCATCCCCGCCAGGCTCACCCCACCAAGGGGAAGGAAACAGCGCGTCATGTCCCC
ACTTTCACCCGCTGCGAGGTGATGGTGGAGAGAGGGCCATAGCTTTATTTTTCTGCCTTTTTCCTCTTTATCTATTAGAG
GGGATCTGCTTCAGCGCCGAGGTGCGTGGCAATTCCGATCTCGGCCAAAGTGTTGAGAAGCGGTGGTGACTCTGAACGTT
GACTGTCAGCGAGGTTCTCTATCTGCGAAGTTCTGCACCCCCGAGCAAAGAGACATCTCACACACCAACGCTGCGATGCC
CATCAGCACGATCAATCTGCCAGACGGGCAGATAATCACAGCCAAGCCGGTGTTTGCAGGGCTTTTTTTCAAGTCCAACG
AGCTCAATGTGCACCGCACGCCCTTCCCCATCGGCTGGACGACGGTGCTGCACACGGAAGATGACGAGACAGGTGAGACT
CCAGGCGAGGTGAGCGGCAGTCCAGGTGGTCGTGGCAGTGTTGGCAGCCAGCCTGGCAGTCCTGGAAGCGCAACGGGCGA
GACGGCCGGGCCGGCTCACTCGCACTCGTTCCGGCGGCCGACGTTGCAGAACGACAGCCTGTTTATCTCGAGCATCAGCA
ACCCGAGCAGCAGCGAGTTCAGGCCGGCAGCGAGCCCGACAAGGCAGATCGCCATGATGCTGTGGATCACGTTATACTGG
TACTTCCACCAGCCGGCGCCGGAAGTGCGGCTGCCGCCAACCGCAGCCTCGCGCGGCACCGTTCCAGCCGGCCGGCCTCA
CGGCGAGTGGCGCATCAGCATCAAGCGTGACGGCGTGCTGCGCGGGCGCAATCTGATCCCCAAGCTCGAGCGCATGGGTC
TGATCGCGACGCTCGAGACGGCGGTCCAGGCCACGCCGGCCACGGGCGACAACGACGGCTGGGATCGCATGTACGTGTCC
CAGGCCATGTTCTGGCAGATCCCGGCCCACCAGTTCCTCTTCACCCTGCAGCCAATCGTGTCGGCCATCGGTGGCAGCGG
AAGCAGCAGCAGCAGCAGCGGCGTTAGGGGCGGCACGTCGTCGTTTCCGGGCTCGCCCACGGCCAGCCGGCCCAGCTCGC
CGACCCGGGATGCAGCCCGGACCAGCGGCCTGACGCTGGACGAGGTGGTCGTCCCGGCGTCTGGCGCGATGGTGGTGGTG
GCTGCGGGCGGTAGCAGCGAAACGGCAGCAGCAGGCGGCACCGACGAGCTCAAGCCGAGCCTCCCGATCGGCCCCTTCTT
TGCGTCGTCGCACCTGCCGGCATACTACCCGCCCAGCCCGCTACGGTACACGATGACGGACGGCGTGCGGCATCCGGCAC
GACCAAAGCCACCGCGCATGGGCGAGGTGTTCTACACGCGCTTTGTCCCGTCGGTCGGCCAGTACCTGTCGCTGCGCGTG
GCGTCGTCGTCGCCGCGGCCGGTGCCGTATGCTGGTCCTGTGGGCCCGCGGCCGCCCTCAGCCGGGGCCCATCTGACGAC
GCTGAGCGACATGGGCCTGCTGCAGATGTGGCTGTCGAACCCGCGGGTCAGCGCGTTCTGGGGCGACTACGTGCCCGACT
TTCTGTCCAGCGCCCTGGCCAGCCGCCACAGCTTCCCGGTCATCGCGCTGTGGGACGGCGTGCCGTTTGGCTATTTTGAG
ATCTACTGGGTCAAAGAGGACGTGCTGGGCCGCCATGTCGGTGGCGCTGCCATCGACGACTTTGACCGCGGCCTGCACGT
CTTCATCGGCGAGGAGTGGGCACGCAGCCGCGTCCAGCAGTGGCTCAGCAGCGTCGTGCACTGGATCCTCACGGCCGATT
ATCGTACCATGAGCGTGTGCATCGAGCCGCGGGTCGACAACTTGAGGTGCGTTGCGTGTTTGCGTGTTGCCGGTCGTGTT
TTCGTTGCTGACAATGCCAGGTTCATCCAACATCTCCAGCTCGGCGGCTTCAACAAGCAGCGCGAGGTCACCTTCCCGCA
CAAGCAGTCCTGGTTCGGCCGACTGGACCGTGACGGCTGGACCGGGCCAGCTCTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62