GenePrediction:GLEAN_6817 Details

Name: GLEAN_6817
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1559185..1558816 (- strand)
Length: 370
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1559185..1559074 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_108:1558994..1558816 (- strand)
Length: 179
>GLEAN_6817 class=GenePrediction position=GCSC_108:1559185..1558816 (- strand)
ATGTCAGCCGGCAAGATGCACATGCGTCTCCCTCCCTTGCGCGTCTTGCGTGTGCGCGAGGTGAAGCGTGAAGAATCAAA
CCCCTGCATTACCGTAATGTCGTCCGTCCTCGGTATGATCACACCTACCCCCCTCCCCTTCACCCTGGTCATGGTCGCCT
GGCAAGGGTTACCGCTGACACCCGGCGACAGCATGCTGGGCATCTTCCGGCTACAGTGCAGCCGGCTGCGCCACCGTCGA
GCAAGCTCTGCGCGCATGCATGGACGGCCCCAAGCCAACTCCTCGGCCGCCCAACAACATTAACTTCCACCTGGCGCGCA
TGGCCAAGAAAGTTAACGGTCCGCGCAAGCAGAACGGCCTCAAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62