GenePrediction:GLEAN_6819 Details

Name: GLEAN_6819
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1547390..1543808 (- strand)
Length: 3583
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1547390..1547329 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_108:1547269..1546162 (- strand)
Length: 1108
Type: CDS
Source: GLEAN
Position: GCSC_108:1545799..1545541 (- strand)
Length: 259
Type: CDS
Source: GLEAN
Position: GCSC_108:1545470..1545283 (- strand)
Length: 188
Type: CDS
Source: GLEAN
Position: GCSC_108:1545226..1545114 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_108:1545053..1544373 (- strand)
Length: 681
Type: CDS
Source: GLEAN
Position: GCSC_108:1544292..1544231 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_108:1544172..1544030 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_108:1543975..1543808 (- strand)
Length: 168
>GLEAN_6819 class=GenePrediction position=GCSC_108:1547390..1543808 (- strand)
ATGGCGGACACAAAAGTATACCGCGCGAGCACGACTGCTCCGGTCAACATTGCCGTTGTCAAGTATGTGTGCCCTGTTGG
GTCCAAGGCCGGCTCCTGCTGACGTGCTTGTCTGTCGACAGATACTGGGGCAAGCGGGATGCCAAGCTCAACCTGCCGAC
CAACTCGTCGCTGTCGGTGACGCTCTCACAGTCGGACCTGCGCACGCTCACGACAGCATCGACGTCGAGCCTGTTTGCCG
GCCAGGACGGCGACACGCTGCTGCTCAACGGCGAGCAGTCGGACGTGTCCGGGGCGCGCACGCAGGCATGTTTCCGTGCG
CTGCGGTCGCGCCGTGCAGCCCTCGAGGCAGCCGATCCATCGCTGCCGAAGCTTTCGACATATCCACTGCGCGTAGTGAG
CGAAAACAACTTCCCTACGGCAGCCGGGCTGGCATCATCGGCAGCCGGGTTTGCGGCGCTGGTGCGGGCCATTGCGGACC
TCTACGAGCTCCCGGACACGCCGTCGCAGCTCAGCCTGATTGCGCGCCAGGGCTCCGGCTCGGCTTGTCGCAGCGTCTTT
GGCGGCTACGTGGCCTGGCGCATGGGCGAGGCGGTCGACGGCAGCGACTCGCTGGCCGAACAGGTGGCACCGGCCTCGGC
CTGGCCGGATATGCGTGCCCTCATCCTGGTCGTATCGGCGGCCAAGAAGGGCGTCTCGTCGTCGTCGGGCATGCAGCAGA
CCGTCGCCACGTCCGGCCTGTTCAAGCAGCGCGTCGCCGAGGTCGTGTCCGGTCACATGGCCAAGATGGAACAGGCCATT
GCTGACCGCGATTTTGCTGCCTTTGCCGAAGTCACCATGCGCGACTCCAACTCGTTCCACGCCACCTGCGCCGACACGTA
CCCGCCCATCTTCTACATGAACGACGTCTCGCGCGCGGCCGTGCGCGCGGTCGAGGCCATCAACGCCAAGGCCGGCCGCG
TCGTGGCTGCCTACACCTTTGACGCTGGCCCGAACGCTGTCGTCTACTACCTCGAGCAGGATGCCGACGTCGTGCTGGCC
ACGTTTGCCGGCATCCTCGGCGCCGTCGACGGCTGGAAGAACGGGCTGCCCAGCACGGCTCAGGCCACCGAGCTCGATGC
CACCGTGGCCAGCACCCTGAAGACGGGCGTCAGCAGGGTCATCTCGACCGGCGTTGGCGAGGGCCCGATGAAGACGGACC
AGTACCTCGTCGGCGAAGACGGGCAGCCGGTGAAGCTCTAAGGACAGGCGTGGCTCACTCGACTGTGTTCTTTGTGCTGT
TCTATATTTTCTCGATAAAGAGGCCTTGCGTGCGAATTGTCCACACCACGTGTGCATAGCGTTTCACGTCTGCTATAAGA
TATCTCCAATGCAATTGTGTCGACCGACGAATATCATTAGTCAGACGTGCGCTAGCCTCTAATGTAAGGCGGTGTAGCTT
TAGCACATACAGTGCGGATACGCAATGCCGACAGTACGAGTAGTTATGTACTCAGCTTTTGAGCTTGAGGATCGATGTTG
CAAGGAAGAACCAGCCTGACCACATGTTTCTGTGTCCTGTCAGATTGCACACGGCAGCTGTCCTCCAACAGTACCCTGCC
TGGTCGCTAATAGCAGGTGTTCAGAGGGGTCCTGACCCCCACGCAATCGGCTTCTCCGCGACGCGTCTTTGCGACGCAGC
ACGATCGAGAAGCACGCACGGCATCCCGCGACCGAGAGAGGCGACGATGGTCCAGCAGACCAAGAAGGCGGCAGCCTCGA
CGGGGTCGTCGTCCAAGCGGCCGGTCGATGAGCACGACCCGTCCATCTCGCCACCGCCGACAAAGCGCAAGATCCAGAGC
AGAACGTCTAGTGAGGCCAGCTACCCCCACGTGATCTTGTAGAGCTTGCGCTCTGGCTGACCAGCTTTTGGCCGGCGCAG
AAAGTGCCGTAGCCAGCTTCTTCACGCCGGCGTCGCAGAAGCCCAAAGACCGCGTCGTGTGGGCCGAGCGGGCGCCTCGC
CGCGGTGCCGCCACAACGCTCCTCGTTGCTCGCTACGAGCCTGTTGCCAAGACTGGTAGCGAGTCGACGTCGGTCCCGAC
AAAGACGAAGATTGCCGCGTTTGATCTGGTATAGCCGTCGGCCGGCCCCCCGCAGCGACGGCACATGCTCACACAACACC
GCAGGACGACACGCTCATCACGACGGCCTCGGGCAAGAAGCACGGCGGCGACGCAGCCGACTGGAAGTGGTGGCACAGCT
CCATTCCCGAGCGCCTGAGAGCACTGCACCAAGAGGGGTATGGTCCGGTGTAGCTTCCTCTCTTTGTTTTCCCAGTCCAC
AAGCTCACCATCCACAGCTACCGGCTCGCCATCTTCTCCAACCAGGGCGGCATCGTGCTGCACCCCGACGAGGCCGCCGC
CAAGAAGACGGGCAAGAACAACGCGGCCACGGCGCGGGCTCGGCTGGCTGACTTTCGCCAAAAGTGCGGCGCCGTGCTCG
CCCAGCTGGACCTGCCCGTGCTGCTGTACGCCGCCACCGGCAAGGACCACTTCCGCAAGCCGCGAGCCGGCATGTGGCGC
GAGATGACAGACGACCTGGGGGGTTCTGGGAAGGGCCATGCTGGTGACAGCGACAGCAACAGCGTCTCCTTCATTACCAT
CGATCTCGACGCTAGCTTCTATGTCGGCGATGCAGCTGGTCGTCCGGCCGTTGCCAAAGATGCCAGCCCAAACGGTCGGG
CCATTGCCAAGGACTTCAGTTGCAGCGACCGCAATTTTGCCAGCAACGTCAGCATCGCTTTCCACACGCCCGACGAGTAC
TTCAACGGCGAGGCCCCGCGCCCGTTTGCCCGCTCCTTTGACCCCAAGGCACACCCGTTTGCCGCTGACGGCACCGCTGG
CACCAACGGCTTCGCCCAAGCCGCTGCCCGAGAGCTCCTCGTCTTCTGCGGTCCACCTGCCGCCGGCAAGAGCTCCTTCT
TTCGCGACTGTCTGGATCCTTTGGGCTACCAGCGCGTCAACCAGGATACGCTCAAGACGTGAGTCGAGGCAGCCTACCGA
GTTGCTACCAGATCCTCTGTCATGCACTCCGGACGTTTGTGCTGACTAAGCATCACAGAAAGGAAAAGTGCCTCAAGGCA
GCCACCTCTTTGCTCCAGGACGGCTCTTCTGTCGCTATAGGTATTCTTTCTCTTCTTTTCCTTCTGACCACCAGTCCTCC
CCCCTGCTGACACTCTAGACAACACCAACGCCGACCCGGCCACACGTGCGATCTGGGTCGCCCTCGCGGCCAAGCACAAT
GTCCCTGTCCGCTGCCTTTGGTTCCGCACCGACATGGCTATATGCGAGCACAATGACGCTGTCAGGGCACTGAACGACAC
TGTGAGTCGCCCGTGTCCCTGCGGCCTCGGCAAGACGCTCTGCTGACACTCCCAGATGAACCCCGAACGCCGCGAGGCCC
TGCCGCGCATCGCCTTCAACGGCTTCTCTGCCCGCTTCCGGGAGCCAAGCACTACCGAAGGCTTCGCCGAGATCGTCGAG
CTGCCCTTCAGCTTCCGCGGCTCTGCCGATCAGTACACCGTCTGGGGACGCTACTGGACATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62