GenePrediction:GLEAN_6820 Details

Name: GLEAN_6820
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1536357..1534765 (- strand)
Length: 1593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1536357..1536250 (- strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_108:1535607..1534765 (- strand)
Length: 843
>GLEAN_6820 class=GenePrediction position=GCSC_108:1536357..1534765 (- strand)
ATGCGTATTCAAACCTGTTATGCATGGGCGCTGGCCCTCACAGCTGCCGCTGGTGGTGTTGAAGCCGTAGAGCAAAAGGA
GGCCGAGTTCAGCAAGGCGCTGACTAAGGTGAGTCTACAGGCCGCTCAGGAAAAAGATTACGCACGGAGCTGGCTTGACT
GACACGGCTCGCAGGAATACACGGCTCCGGCTTCTCTCGGGCCGGCGATAACGCAACCGGCAGTCCTTCCTCCGAGGCTA
GATCTACGGTCCGACAAGGACAAGGATGTCGACGACACAAAGTCGACCGCGTCGACAAAGGAGACCACCTCGGACAAAGA
CAAGGACAAGAAAACGACGACGAGCAGTGAGACGCCATCGACTGCAAAGACCAAGACTACGACGACATCTACGACCACGT
CGTCTACTTCAACGACCCCTTCGAGCACGCCGGCCACCACCTCGACCTCGTCCTCTTCTTCTTCTTCCCCTTCAGCATCC
TCTACCTCTCCCACGACAGAGTCCACCCAGGCAGCGGCAACTTCGGCAGCATCGACGACAGCATCGTCAGCAGCAACGTC
AGCAGCAGCAACAACAGCGTCGTCCAGTCCGATCACTTCTGACGCCGCATCGACGGCCGTAGCCAGCACCATTGGCTCCA
CAGCTAGCAGCACTGCCACGACGGAATCGACGTCCAAAACCAGCACCACTGCTGCCTCCACGGCTGCTGCGACCAATGGC
AGCACCAACACCAGCAAGCACCACAAAAAGCACCTCAGCACTGGGGGCATTATCGGCATCGTCATAGGCTGTGTGGTGGC
CATTGGCGTCGTCGCCTTTACGGCTGTGCGTATGGCCCGGCACGCCCGTGCATCCCGGGAAGAGCGACACGGCATCTTGG
GCGGCGAGGACTCGTTTGCCTTTGAGGGCGGTGGTCTGCCACCGGCCGCGACAGCCGTGGCCGGAGCAACAGGCGTCCGC
ACGTCGACTTTTTCGCTGGCTGGCGTGGGTGTGGGGGCGAACTCCATTTCCAGCACACAAGCCGGGATGAGGGGGTCGAC
CTATTCCAGCCGGCCGGTACAGATGAGCGAGATGCGGCCTGGCACGTCCTCGTCCTTCACCCCCTCCTTGAGTGCGCAGC
AGCAGCTCGCCCGATACTCGGTGCGGTCATCCACGATACCGGCCTGGCAGAATCAGGCACGAGGCAACGGTCCAGCAAGT
CCTACGAGCCCGACGAACCCGATGAACCCGATGGGTCTGATGGGCCCAATGGGTCCAGTGAGCCCGACGAGCCCGATGTA
TGCCGGTATGTCGGCGCCGGGACTGCCACAACAACCTGTGCGAGCGTATGTGCACGAAAATGGCAGTCTGGCCAGCGTGC
AGAGCTCAAACAGCGATGGTGGTGGGCTGTTGGCGACGGCAAGACCGCTGTCGATGACAAGACCGCTGTCGATGGCAAGA
CCGCTGTCGATGGCAAGACCGCCGTCGATGGCAAGACCACCGTCGTCCCTGCGGTTGAGCCATGTCGCCAATGCACCGCC
ATCGCCTGGCATTGCTCCGGGCTCAGCGCCTGCCATGTACAACATGAACGAACAGAATGGGGGACAGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62