GenePrediction:GLEAN_6823 Details

Name: GLEAN_6823
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1524759..1522948 (- strand)
Length: 1812
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1524759..1523316 (- strand)
Length: 1444
Type: CDS
Source: GLEAN
Position: GCSC_108:1523267..1522948 (- strand)
Length: 320
>GLEAN_6823 class=GenePrediction position=GCSC_108:1524759..1522948 (- strand)
ATGTCCACCGCGGCTAGTACACTGGCAGCTCCCAGGCAGCCAGAGGGCCTGACCTCGTCGCAGGCGTCGTACACGTCTAA
CTCGGTCGACATCGAGAAGAAGGAGGCCGTCGAGGCCGAGGACGAGGAACACGGCACTGTCGATGGCGAGTCCACAGCTG
ACGACAATGACGACTATCCCAAGGGCGCCAAGCTGGCCATCATTGTGCTGGCCTTATGCCTGTGCGTCTTCCTGATGTCG
CTCGACTTTGTGAGTCCCGGTCTGCTGCCTTTGGAGCCCCCCCACTCTCTAACAGGTCAGACCATCGTGGCCACGGCCAT
CCCCAAGATCACAGACGAGTTCCACGGCCTCAGCGACGTCGCCTGGTACGGCTCAGCCTTTTTTCTCACCGTCGGCGGCT
TTCAGTCGTCCTGGGGCAAGGCTTACAAGTACTTCTCCCTCAAGTACACCTACCTGACCTCTATTGTCATCTTTGAAATT
GGAAGTCTCGTCTGCGGCGTCGCCCCGAGCTCGCGTGCTCTCATTGTCGGTCGTGCCATTGCTGGCATCGGTGCTGCCGG
CATCGGCTCCGGCTCCTACACCGTCATCGTTGTCACCGCCAAGCCTAAGAACCGGCCGCTGTTCACCGGTATCATCGGTG
GTGCCTACGGCATCGCCTCCGTCATCGGTCCCCTGATCGGTGGTGCCTTCACCGACAAAGTCTCCTGGCGCTGGTGCTTC
TACATCAACCTCCCCATCGGTGGTGTTTCCGGCTTGATCATCCTGCTCTTCTTCACCACCCCCAGCCGCGCCAAGCCGGC
CGTCGCTCCCCTTCGCGAGAAACTCCTCATGATGGATCCCGTCGGCATGGTCCTCGTCATGGGTGGCGTCATCTCCTACG
TCCTCGCCCTGCAGTACGGCGGCCAGACCGACCCTTGGCACTCCGCCAAGGTCATTGGCCTCCTCATCGCCTTCGTCCTG
CTCTTCGTCATCTTCGCTGTTTGGGAGTACTTCAATGGCGAGCGCGCCATGATCGTGCCCCGGCTCATCGTCAAGCGCAC
CGTCTGGGTCAATTCCCTGTTCTCCTTTTTCTTTGCCAGCTCCTACTTCACTATCATCTACTACCTGCCCATCTACTTCC
AGAGCATCGACAACGTCAACCCAACACAGTCCGGCGTCCGCAACCTGCCGCTCATCATCGCCGTCACCATTGGCACCGTC
CTCTCCGGCATCATAATCACAAAGACCGGCCATGCCACCGCCTTCCTCCCACCCCTTACCGCCCTTGCTACCGTCGGCAC
CGGCTTGCTCTATACCCTCAACGTCGGCACGTCTAGCGGCCGCTGGATCGGCTTTCAGATTCTCGCCGGCTTCGGCTTCG
GCTTCGTCTTCCAGATTCCCATGATCCACGGTCAAGGAAATGCTGCGCCCGAGGACCTAGCTACCACCACAGCTGTGCTA
ATGTGTACGTGTTTGATCTTCGATATATGCACTTGACTTCACCCACTAACAGTCGCAGTCTTTCAAACTATTGGTGGTGC
CTTTATGTTGTCCGCCGCCCAGTCCGCCTTTGTCAACCACATGATCTCCGTCCTGCCGAAATATGCCCCCTCTGTCAATC
CGGTAGTTGTCATATCTACCGGCGCCACCGAGCTCTGGAAAACCTTCCCCCCTGATGTCCTCCCAGGCATCTTGCAGGCT
TACATGGCCGGCCTCCGCGTCACCTTTGCTATTGCCATTGGTAGCGTCGGAATGGCCTTCATCATCAGCCTTTTCAGTTC
CTGGAAACCGCTGAATCCGGAGGCATTAAAAAATGCTGGCGGCGCTGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62