GenePrediction:GLEAN_6825 Details

Name: GLEAN_6825
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1516527..1512865 (- strand)
Length: 3663
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1516527..1516262 (- strand)
Length: 266
Type: CDS
Source: GLEAN
Position: GCSC_108:1516203..1515270 (- strand)
Length: 934
Type: CDS
Source: GLEAN
Position: GCSC_108:1515207..1514156 (- strand)
Length: 1052
Type: CDS
Source: GLEAN
Position: GCSC_108:1513375..1512865 (- strand)
Length: 511
>GLEAN_6825 class=GenePrediction position=GCSC_108:1516527..1512865 (- strand)
ATGAGTGGCCAGAAGGGAGAAAGCCCAGAGGACCGCCTTATTTACGGAAGTACCTTTGGGCCCAATTCGCTCGCCAACCT
CGGCAACATCCACTTCCACACCACGCCCAATACGCATGTACAAGGGCAAAACCCTGTCCGGGCCATTCCGTATCCACAAA
ACGAGGAAGCCGTCGACCGAACGGAGCTTGTCGGCCGGCTTAACGAGCTCCTCCCGGCTTCGTCCCGGGACTGCAGTGCG
GCGCTATGGGGCCTCGGCGGGTCAGGGTAGGTTTTATTTTTTAGTATTATTGTCGGAGCGAGCTGTGGCTGATTGTCACC
ACAGAAAGACTCAGATTGCGTTGGAATATGCGTACAGACGAAGCCGTGATCACGGCTGCTCCGTCTTCTGGGTACATGCC
GACAGCAAGGCAACTTTTGTACAGGACTACCAGACGATAGCAGTGAAGCTTGGCATAGAAAAGAGCTTTCAGGGTAGTGA
TCTGCTTGTCGAAGTGCGCAACCGCATCGAAGCTCTGCCGAGATGGGTGCTTGTGCTCGACAACGCTGACGACCTCACTA
TCTTCGGCGTCGGGCCGGGAGCAGCGTCGACGGCAGGCAGCCTGTTCGACTACGTCCCTCGTGGGACGGTTCTGTGGACG
AGCCGCGACGAGCAGATCGTCGGCACGCTGGTTGGACCAGGCCGCGGTATTCGGGTAGGCCACATGACAGCTGTCGAGGC
TGAGATGCTCTTGCAGACGGTCAGGCGCCAGGATGCAGGCGATGAGGCGGACGAGGTCGCCGAGCTGCTGAGAGAGCTGC
TGCAGTTTCCGCTCGCCATCTACCAGGCAGGATCATACATGCGGCGAACGGGAACTCTCGCCCGGGAGTACCTCCAGCTG
CTGGCACAGAGCAAGGAGCGACACAAGGCTCTCAAGGCCACGGCGTACGACCGTCACCGGAGAACTGGCACGCCCAACAG
CATCTTGGAGACCTGGAGGGTCTCTGTTGACCGCGTCCGACGCGAGAGTGAGATGGCATACCGGATCCTGCACACCATTG
CTTTCCTCGACAACCAGAACATCCCGCACGAGATCCTGGTGGCTGCCTGCAAGCTCCACAGCCGCGACGCTGTCGAACAG
CCAGACAGCTTCGACGTCATCCAGGACATTACCCGCCTGAAGGAGTTGTCCTTGATCGACGTTCGCCGGACAGACGACCG
TAGCCGTCGCTACGAGATGCACAAGCTTGTCCAAGAAGCGACGAGATACATGCTCGATGTAAGGAAGCCGGCCTGGGTCT
TGGCAGAGAAAGCAGAAACTAACAGTCTACCGCGTCAAAGAAAGAGATGAAGGCCGTCTTTGCAGGCGCCGCTCTCGACA
TCATGGTGGGTCTCTTTGTAGAGCCGAGCCAGGCGACCTGGCCGCAGTGCGACAAATACCTTGCACATGCCGTCCAGGCA
GGAGAATGGACCGACCTGCACGGAAACAAGGCCGGGGCAGCCTCGCTCTTTGCCAGGATCTCGGCCTACCTGGGCGGTCG
AGGCCGCTGGAACGAAAAAGAAGCTGTAGATCGGCGAACATGGGATCTTCGACGGGAGGTGCTTGGAGAGATGCATGTAG
ACACCCTCCAGAGCATGGCATCTCTCGCACTGACGTACCATGAGCAGGGCCGCTACAGCGAAGCGGAAAGCCTGAATTTC
CGGATTCTACATCTTAGGCGGGAGCTGCTCGGCGAGAACCACCTGGATACGATCAGCACCATGTCCGATCTTGCAGGAAC
GTTTTCCGATCAGGGCCGGAACGACGAGGCCGAGAAGATCCTGGTCATCGTGTGCAGTCGTCGGCGGAAGTTTCTTGGCG
ATAGGCACGAGGAGACTCTGCAGGGGATGTCGTATCTCGCGTCGACGTACCATGAGCAAGGTCGATACGACGAGGCAGAG
CGGCTCAAGATCCAGGTCTGTCGACTCAGGCAAGAGGCGCTGGGCGAAAAGCATATGGCTACGATCTTTAGCCTGAGCTC
TCTCGCCGTGACATATCAAGAGCAGGGCCGCTATGACGAAGCCGAACCTATCCGGGTCAAGGTCCTCAAGCTCCGGCGTG
AGATGCTCGGCGAGACGCACCCGGACACGGTCAGGAGCATGTCCTCGCTCGCAGTGACGTACCGAGAACAGGGTCGTTAC
AGCGAGGCCGAAGCTCTGGCTGTCCGAGTGGTCGACATCCGGCGGGAGTTCCATGGCGAGATGCATCCGCGCACGATCAA
GAGCAAGATTCACCTGGCAGCGATATACCATGCACAAGGACACTACGAAAAAGCTGAGTGCATGTACGCCGAGACTTGCA
ATATTCTGCGGAGGCTGTTTGGCACGACGTACCCGGAAACACTCCTGTCTATGTATGGCTTGGCTGTAACCTGGCACAGC
TGTGGTCGTCGTTGTGAAGCACTTTCCCTTATGCAACGGTGCTTCAATCTGCGATGCTCCGTCCTTGGGCCGCGACATCC
TTTCACAGAGCGGTCTGCACAGATCTTAAGAGAGTGGACAGAAAGCATGGACTTGTCACCATAGGCATGGGGATTGCTAG
ATGAGCGCCCCGAAATTCTACATAAGCGCCCTGCACACAATACACGTGACTTTGCGAACGTCCCTAACTGCGCCGAAAAT
TTTGCGATTCAATAACTAGAAATGCATTACTAAACTAACAATAGGCCTATACTTGTCAAATTATGGGTGCCCAGTGAGCG
TGTGTATATTGTTTATGGTTGGCTACTTCCGAGCTATGCCAACGTGCTGAAATCCCATACTACGAGCGTAAATAGCGCCC
TGCGCCACACGGAGGACATGTATTCTTCCATCAAGGTGGATGGGATATTATTCGGACTCGCCACAGGTGCACTCACCAGA
TCTAAACGGTGGCAACATCTCGCTCGACTTTGGCAGCCTTACTTAACAGGGCTTTCAGGCGTGCAATAGCGACCGTTTCC
ACCGTTAGAAGTACTGCTCGGTTGTTTACAGTGGCAAAGATCTGAAGACGCGCCTGAAAATACCTCTTTAGCAGTAAAGC
TGCCTGTGTTTACATACAACTCTACAGACCTATAAACATGTCTCTCGGTGTCCTACGCAAGGTTCCACGCAGGCAACTTG
GACCAGCAATGATTATCTCACTGTGCCAAAAGCGATTTGTCGACCACGCATCGAATGAAGGGATATCTGCCTACTTCGGC
CAGACAGCTCGCATCGCTGTCTGGCAGCAACAACGCGGTCCTACCACCAAGCTTCTCGTTCCAGGTCTACGTTACGTATG
GCCCGACTCTGGCAGACACACCCTCTTTGCTTGCACAAGACTTTGTTAAGCGAGTAATGGCCGTAATGAACAACAATGGC
CAATACGATTACCCTATCCGGTTTGACTTCCACTTTCTCCCCGGCAAGGCCGTCAACGAGATTATACAGCACTACCGCGC
TGAAGGCAAGGCGGAGCCTGATTACTCGAAGCGACCGGATGATGACTACCGCGGCGTTGCAATCGCGCTGTCTAAGGAGA
GCTGGGAGCGAGAGGGCGCGGACTTGATCCTGTTCGACCCGCCTGCGGAGTATCTGCAGACAACAGGAGAGGAACGGGAT
GCTATTCTAGGTAAGGGCGTCGGGGCTAATGGCGTCCTAGTCTTGTACGGGATGTCGGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62