GenePrediction:GLEAN_6828 Details

Name: GLEAN_6828
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1492933..1492155 (- strand)
Length: 779
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1492933..1492765 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_108:1492693..1492155 (- strand)
Length: 539
>GLEAN_6828 class=GenePrediction position=GCSC_108:1492933..1492155 (- strand)
ATGTCTTCCAGTGTTCCAGTACAGGCCCAGACCAGTATTTCTGGCAATGGGAGCAAGCCCCGAGCAAAAATCGGTGTCTT
CTGTGGCTCAAGCAGCGGCACCAACCCAGCATATGTGGAAGCTGCCCAAGCTCTGGGAAGGGCATTGGCAGAGCACGACA
TTGATTTAGGTATGTTTTCGGCCAATGTTACTTACTCTTTCCAATAAGGACAAGCATTTACTCACCTTGCGAAATTGTAG
TCTATGGGGGCGGTACCGTCGGCCTGATGGGCGAAGTAGCAAAGGTTGTTTGTTCGATCAGAGGACCTTCAGCTGTCCAC
GGCATAATCCCTCAAGTTCTAGCCGAGCACGAACGCACCGACGCATACCAAATCGCCCAAGGCGACCTTTACCTGCCTGA
CGAGTCCAAGTATGGCCGCACAACCGTGGTCCAGGACATGCACACTCGCAAGAAAATGATAATGCGGGAAGTTCTTAGCG
GTGGCCCTGGTAGCGGCTTCATTGGCCTTCCCGGCGGATATGGCACCATGGAAGAGCTTTTTGAGGTCATTACGTGGAAC
CAGTTGGGCATTCACCAGGTGGGCGTTTGCTTGGTCAACACAGATGGATTTTGGGACCCGATCGTTCAATGGGTAAACAG
TGCTAGCATGAATGGATTTGTAAAACCGGAAAACAAGCACATTGTGGTGACGGCTAGCGAGCCCGCGAGAGCGATTGAAG
CGCTACGAGATTACAAGGTATCTCCAGAGGTATTTAAGCTGGGATGGGCGAATTTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62