GenePrediction:GLEAN_6830 Details

Name: GLEAN_6830
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1487897..1487011 (- strand)
Length: 887
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1487897..1487533 (- strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_108:1487368..1487011 (- strand)
Length: 358
>GLEAN_6830 class=GenePrediction position=GCSC_108:1487897..1487011 (- strand)
ATGGCTGACTGGGCAGGATCCAATTTCACCGAAAGTCGCCACACGGATACGTATCTTACGATCGACCCTAGCAAGCTCGA
TTTTGGTGGGCGCTACGTCTTCATTACCCGCGCGTCCAAAGGTATAGGCCGGGACATAGCTCTGTCGTATGCAAGTGCCG
GAGCCGCCGGTATTGGCATTGGGGCGCGGTCGGACACGGCGGACCTGCCGGGGCTGTTAGCAGAGGCAGCGCGCATGGCC
GGCCACACAGAACCCAAAGTTGTAGCTGTGTCCGTTGACGTGACCGACAAGGATAGTGTCGCAGCGGCGGCCGTAGCCGT
GGGCGACGTCTTTCCTCGTCTGGACGTGCTGGTCAACAATGCCGGGTACATGGAGATTCACCAAAAAAAAATGGCGAAGG
CGACCCGGCTGAGTGGTGGAAGACGATATCAGTGAACGTACTGGGGCCTCTTCTTGTGACACGTGCCTTTTTACCACTGA
TGATTGGCCGTGGTCCCGGTGGCTTGCGCACAGTCGTTAATCTGAGCAGCATCGCCAGCCATGTTCTGTGGACTGGTGCG
GTTGCTTACCATACGAGCAAGCTGGCGGTTCTGCGTCTGGCCGAGCTTCTTAACGTCGATTACAGCAAATCTGACGGCCT
ATTGGCCTACTCGGTACACCCAGGCATCTCGCCTACTGATATGGGCAACCGCCTTCCGGAGTATCTTACCTCGAAAGTTA
CTGATACGCCAAAGCTGGGCGCCGACACTGTCGTGTTCCTTACCGAAAAGCGCCGTGACTGGCTTGCTGGTCGCTACATT
GCGGCCAACTGGGATATGGACGAGCTTCTCTCCCGGGAGAAAATAATTGTGGAGGGAAACAAACTCAAGGTGCGGATGAT
TGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62