GenePrediction:GLEAN_6831 Details

Name: GLEAN_6831
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1482636..1481301 (- strand)
Length: 1336
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1482636..1482270 (- strand)
Length: 367
Type: CDS
Source: GLEAN
Position: GCSC_108:1482216..1482092 (- strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_108:1482026..1481301 (- strand)
Length: 726
>GLEAN_6831 class=GenePrediction position=GCSC_108:1482636..1481301 (- strand)
ATGTCTGACCAGCAGAATTGGGTCGGCCCTGCCGTCCAAGCATTCACAGCGGCAGTTCCAGGTCCAGCAGCGCCTTTCTT
GCGGGGGCTGCGCAACTACCTCACCGTTCCTCTCCCAGCATTACACTCTGTGCAATGGATTCCGGCATTACAAGAAGTTG
AGATCCGGCTGGACCTCGCCCGCAAACTCCGTCAAAATCTGCGCAGCTATGGGCTGGCGCTACACTTTGAGTTTACTGCT
CTGGAATTGTCGGCGCTTCTGCTTATGCCTATTGAGTCTCTGCGTCAGCTGACGAGTAATACTTTGGCTGAGACCCGAAG
CTTCTATTATCTGACGCTGGCCGGAATCAAAGACAATTTAAAATATTGTGAGTCCCCTCCTCTCATTTTACTACTTCTCG
TGTCTTTCTGACGTCTGTAGTCCTCGAGGGACACCATCCGCATTCGAAAGATCTTAAGCGCAAGACTCCCGGAGGAGGGG
CTGAGAGCATCGAGGGCACACTAGGAGCCAAAAGCGTTGGCCGCTCGGAGGCTGAGAAACAAAAAGTATGTACGAAGTTT
AGCCCTTCCACAGTGTACCGAAACGGCTACGTCGGTACTAACCCCAGTAGTGCCGGCAACGAGACGGGAATGTGTGCATT
TTCACAGGCGCAGCGCACCCCGACGTTTGCCATATAGTGCCATTCGCGACGAGCTCTACCGAGAGAAACATCGAGCTGAC
GAATGGACGATTTGCAAATATCTGCAGTATGTTTTTGCCCGCTGCTGATGAGGAATACACCCCAGTTATCGGGAATGGCC
TTGGTTGTTCCGACAAAGCGTGGAACATGCTCTGCATCAGCACGGAGCTTCACCGCTACTGGGCAAAGCCCTATTGGGCT
GTCAAATTTGTCGGTATCACGCCTGCGGAACACGTTCCGAAGCAGAGACTCACCATGAGATTTGAGTGGTTACGCATCAA
GAATGGAGACCCGAGCCGCACAATCAGCGTGGGCGACTCTACGGCCTGCCACGCAATGCTCGCTGGCTTAACAACCTCTT
CCACCGGCGAAGAGGATGCTTGTCCTTGTCTAGGAGTCGAGGGGATTGTGGCAGCCAACTGCCGCAGAACTAACCGTCCA
CTAGCGTCTGGCCAGGACTTTGACGTTGTCCTTGACACGTTAGGTGATGCCCTCAATATGAAAAAAATGCTGGAGATCCA
GTGGAGCCTTGTCACACTCGCAGCCATGAGCGGCGCAGCCGGCCCTGACGACACAGGCGATGACTTGTCTGAGTTTGAAT
TTGAGAGGGAGGCCTACGAAAGTGCCAACAGTGCAGTATACGATGATGACCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62