GenePrediction:GLEAN_6833 Details

Name: GLEAN_6833
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1462864..1461473 (- strand)
Length: 1392
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1462864..1462820 (- strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_108:1462497..1462470 (- strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_108:1462395..1461473 (- strand)
Length: 923
>GLEAN_6833 class=GenePrediction position=GCSC_108:1462864..1461473 (- strand)
ATGAACGGATGGGGCCGTGGCACCTCTGGGCTTCTCGGAGTCGTCGTAAGAGGGATCGGCTGCCCATATTATTCGCAATT
GCATTCGTACTCCTCGTCCCCTCTTGCAATCGACCATCCGTCCACCTTGTCATCTTCCACTCATCCGCTAATCTGCCCGT
CTCCTGGAGAGTTTGGCACTACTTTTGCTTCTTTTCTTCCGTATATATTGTTTTCATCCTTCCTATTCCAGTACACCGGC
TATCCTTCTCTACCAGGTTCTTCTGTCATTTCGCTCTCTCTTCTTTCTGTATCTTGTCATAATGGCCATGTCTCTCGTTA
AAACCTCTCTCCTTGCCCTTCTTCTTGCTTCTCCCATTTTGGCACAGACCTCGACGGACTGTAGCCCCCTGAACAGTGAG
TGCGGTTCCAGCCGTATACCTGACTCCGAGACCGCAATGCTGACCTTGATGTCTTTCCCCCTCCGCTAGCGACATGTGAC
CCCGACCCTGCTCTTTATACGAGCACGTACACGGTGGACTTCACCAAGGGTGCCGACGATGACGCGTGGGCGAAGGTTGC
GGGCACCGTCAACTACACATCAGCGGGTGCCGAGTTCACCGTCAACAAGCAGGGCGACTCGCCTACGATTCAGACGTCCT
GGTACTTCTTCTTCGGCCGTGTTGAGGTCCACATGCAGGCTGCTCCAGGCCAAGGCATCGTCAGCAGCGCTGTGCTCGAG
TCTGACGACCTTGACGAGGTCGACTGGGAATGGCTCGGCGGCATCGACAACCAGGTCCAGACTGACTACTTTGGCAAGGG
CAACACGACCTCGTATGACCGTGGCGGCACCACCAACTTGACCGATGTCCAATCTATCACGCACAACTACACCATCGACT
GGTCGTCCGAGCGGATCATTTGGTACATTGACGGCTCTGCCATCCGCACGCTGAATTATGCCGACGCCCTCGACGGCGCG
AACTACCCCCAGACGCCCATGCGGGTCAAGCTCGGCATCTGGGCCGGTGGCGACCCGGACAACTCGAAGGGCACCATCGA
GTGGGCTGGCGGCGAGACGGATTACACTGCTGGCCCCTACACCATGACCGTTCACAATCTGACCGTCTACAATGCCAATC
CGGGCGGCTCTTACATCTATGGTGACAAGACCGGCTCCTACAGCAGCATCGAGATCTCCAAGGACAACGTCACCTCTACC
ACCTCGTCGGCCACTGCTAGCAGTACCAGCAAGTCCAACAAGTCCACCAAAAGCTCCTCTTCAACCAGCTCTACGTCCAG
CTCTACGTCCAGCTCATCGGGCGTCACTACCTCGGCTGGTAACTCAGTCTTGTCTCAGCTCACCCTTCTCCCCGGCATGC
TTGTTGCTCTGGTGGCTTTCTACATTTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62