GenePrediction:GLEAN_6835 Details

Name: GLEAN_6835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1456779..1455732 (- strand)
Length: 1048
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1456779..1456488 (- strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_108:1456382..1456078 (- strand)
Length: 305
Type: CDS
Source: GLEAN
Position: GCSC_108:1455845..1455732 (- strand)
Length: 114
>GLEAN_6835 class=GenePrediction position=GCSC_108:1456779..1455732 (- strand)
ATGGCGCCAAAGAGGGAGCTGTCCGAATCCAGAGCAGAAAGGTCTGACGATGCTAAGTCCACAGCGAGCAGTCCAGAGAG
ATTTCCATCTCCCGCGCCGGCCAACCCGCCTATTCCCTCAACTTCGTTTATCCAGCAACTCGCATATGCGGAGCGCTCAT
ATCGCTCAAGCGACGCAACATTCGAGACCGCAGATAGCATGCCCCCGTGCATCAATTGCATCGCCGAGTTCCATTATGAC
ATCCTGGAAATGTCGTGCGATGTGACACCAGATCATTCAGGGAAATGGATGTGTAGGACATGTGAGAGCAGGAACCATGT
CTGTCGACCGGTAAGTTGCAGTCGGTCTGCATTGACTTGACAAGATTTAACGAAACAGATTCCTCGCCCGCTACTAGGCA
TCGCTGCAAAGCTTTGGGCTGCAAACCTTCGGATTCGTGCCTTTGTCAAAGCCAACCATCTGGCCGGAGTCAAGACCCAA
CGTCGAGCGGACGCCCTCAGAGATAAATACGGGAAACTGCGCACGTCTCTGGACCACATCAGTGACATGAATACTAGGTT
CGGGAAGCTCGCCAACCGCGCCTATGAAAACACTGCATCCGAAGACAAGGACGGCGTGTCGTCTGTCCTGTACGAGCTGC
GGTTACAAACGCGCATATTAGCTACCAATACGGCGCTTCTGGCCAAAATGGTGCCAAGAAAGGTACTAAGACTCTCCTTT
CTGCGTTTTGAGTTTGCTAACCTGAAGAGAGGGGCATGAATGATGATGAATCCAGTAGAAAACTGAAAACTGCCACGAGT
GCGCTTGTGAAGATCTTCGAAAAAGAGATATTTCCGCCCCCGATTGAATTGGTTGAGCTAGTGGATCGCATAAACACAAT
TGTCAGTCAAATGACGAGTCCCAATATTCATATTTCATACTAACGAGATTCTAGCCTAGCATGGTATGGGAAAACGAACT
CTCAGACCATGTCTTGCTGGCCTATCTCATTTGCGTCCGTCGCGGCGAGCAGTTCCCCAACCGCCCAAAAGACCTGGCTG
CTGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62