GenePrediction:GLEAN_6836 Details

Name: GLEAN_6836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1451384..1447816 (- strand)
Length: 3569
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1451384..1450941 (- strand)
Length: 444
Type: CDS
Source: GLEAN
Position: GCSC_108:1450852..1450507 (- strand)
Length: 346
Type: CDS
Source: GLEAN
Position: GCSC_108:1450448..1449203 (- strand)
Length: 1246
Type: CDS
Source: GLEAN
Position: GCSC_108:1448643..1448491 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_108:1448419..1448251 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_108:1448196..1447816 (- strand)
Length: 381
>GLEAN_6836 class=GenePrediction position=GCSC_108:1451384..1447816 (- strand)
ATGACTGCTCCTGCCGACTATTCCCATCCTCTGGACCCGGCTACGGCCGAAGAGATCCAGCTGGCCATAGATCTGGTGAA
AAAATCGTTCGCTCCCACGGCGCTGCACTTCAAGGCGGCTGGTCTCGATGAGCCGCCGAAGAAACAACTACGTGCGTATC
TGGAGGCCGAGCACGGCGGCCTGCCGCTGCCGAAAGTCCCGCGCTGCGTCTTTCTCATCTGGTACATCAAGCGCAGTCCC
CGTCTGTTTGAGGCGGTTGTGGATGTGACCAGCGGGAAGCTGGTCTACCAGAAGGAGTTGTCTCGCGACTTCCACGGGCC
TGTCGACCGCACAGAGCTCAACGAGGCCGCACAGGTCGTGCTAGATAGCCTAGACGTCGAGAAGGAGTTTGTGCGCCTTG
GCATCGAGAAGTCCTCGGTTGTCCTTGATCCCTGGGACTATGGCGTTGACGGACTGGAGACGCAAGAGCGCAGGACACAG
GCATGTCTCTCCTAGGGAAACTGAACAATTTGGGGCTCTGCTGACTCTTTAGGTCTTCCTCTACCGCAAGAACCCCAAGA
ACAACGACGTCGACTCGTCGCACTACTCCTTTCCGCTCGACTTCATGGTCATTGTCAACCTGTGCTCGATGACGGTCGAG
AAGATCACCCGACTGCCTCTCGGCGCTGACGAGAGCACGACAGAAGGTGCCGGCGTGCCGCTGCGCGAGACCGATCCGGT
CGAGCCCGAGTACGACCACCGACTGCAGAAAAAGCTGCCGCGGACGACCCTGAAGCCGTACAATGTGGTGCAGCCCGAAG
GTGCCTCCTTCACGGTCAAGGGCCACCTGATCGAGTGGGAGAAATGGCGGTTCCGTGTCGGCTTCAACTGGCGCGAGGGT
GAGTTCTTTTTGGCGTGGAACATCGAGCTCCTCTTCTCGTTTCTGATCGGTTGCAGGCCTGACCATCCACGACGTCCACT
TTATGGGCCGCAGCACGTTCTACCGTCTGTCTCTGTCGGAGATGTTTGTTCCGTACGGCGATCCCCGCAGTCCGATCTAC
CGCAAGGGTGCCTTTGACCTAGGAAATGTCGGTGCCGGCATGACGGCCAACAACCTTCAGCGTGGGTTTTGTCATCTCTC
CTACTGTCTTCTTCTGACTAATCCGCCTCCAGTCGGCTGTGACTGTCTCGGCACGATCAAGTACGTCAGTGGCCATGTGG
TCGACGCCGACGGCACGCCGTCTGAGCGGCCCAACGCCATCTGCATCCACGAGATCGACAGCGGGATCCAGTGGAAGCAC
ACGAACCATCGCACCGGCAAGGCGACGGTGGTGCGCAAACGCCAGCTGGTGCTGCAGATGATCATCACGGTGGCCAACTA
CGAGTACATATTTGCCTGGATCTTTGACCAATCGGGCGAGATCTCATTCGAGACCCGGGCCACCGGCATCCTATCGACGC
AGCCGGTCGACGCTGACTCGGCCATCCCATTTGGCACCCGCGTGGCCGACGGCGTGATGGCACCCTTCCACCAGCACCTG
TTCAACGTGCGAATTGACCCGGCCGTCGACGGCCACGCGAACTCGCTCGTTTACGCCGACTCTGTCGCCATGTCGTGGGA
CCAGAAACTGAACCCGCTCGGGACCGGCTACGTCTCGGTTGAGACAACGGTGCAACGCGCTGGCCCCGTTCCGGACAGTC
TCCCGGACGGCCGCGTCTTCAAGATCGTCAACCCGGCTGTCCGCAACCGGGTCTCGCACACGCCCGTCGGCTACAAGATC
GTCCCCATTCGCTCCCAGATGCTTCTCGCTCAGCCCGGCTCCTGGCACTGGAAGCGCTCCGAGTTCGCCGAAGCTGCCCT
CTGGGTCACAAAGTACCAGGACCGCCGGCTCTTTCCCGCCGGCGATTACACCAACCAGTCCCTCGGCGGCACCGGGATCA
AGTCCTGGGTTCGCGATCCCGACTTCGTCGTGGACGAGGACATTGTCATCTGGCACACCTTTGGCTTCACCCACAACCCC
CGCGTTGAGGACTTCCCCATTATGCCGGCCGAGATCGTCCAGATGCACCTGAAGCCCTTCAACTTTTGCGAGTACAACCC
GACCAACGACGTTCCTCCGTCCAACCAGGCCTTCAACAAGAGCACCCTCTACGAAGATGTCGCCAAGGGCAGCGCCGGAG
CTTGTTCCGGTACCTGTGGACAGTAAGACAGAGAATAGAGGATAAATAGGGAATAGATACTTGCAACTTTGACAAGGAAA
CTCGTATGCATCGAAAATGTCAAGCGTCGGGAAGCCGACTTCCAAACTAGACTCAACAATGACGAAGCGAGTCACTTCGG
CTATCAAGACATTTAGAATGGGGCTAAGTGGCTTTTCTAAGACAGCCCTCCTCTGACTCGGCCCAATGTATCGATAGCGC
CCTTTACGCTTTTGTATTAAAATCCAATGGTGCCTATGTCGTGTGGTGAGCTAGACTGTCTTATCACACAACAATATCTG
GAAACTGGGTGCACTCTCAACCATGACAACTCAATCGACGACTATTCGTGCAGAGGTACATGTAAACACCCGTACAGGGC
TTGGGGAAAGCCCGGTATATCGCCCAGAGGACAATACCCTACATTATATCGATGTGCCAGGCAATGTGATCCACATCCTG
CAGTTATCCGAGCCATGGAATCATCGGTCCATATCTACTCCTCAACCGGTGGCCTCTCTCAATTTCTCAGCGGATGGGGG
CTATACCGTCTGTTACTATAGAGGAATAGCCCACGTCGGGGAAGACGGAAGGTGGACAGAGCTTTGCGAGGTGGTGAAGG
ACGACAGGGCGAACCTCGTCCGGATAAACGACAGCGCTGTTGACCAAAAGGGCCGTCTATGGTTTGCCGAGTTTGAACTC
GCATTTGAGACTCCGTAAGCTTCAGTGTCGACTCTCGATTGGAATGCGATAGGACAAAATCTAGCTAACAGATATCCGGT
CACAGCGGCGATGGCCCTCACCTGTCAAAAGGCCATAAAGCATGCGGAAAGCTATACAGCTACAGTGCAGATGGAACGTT
GGTCGAACATGAGTCGTCGGGAATTTCTTGCGGTAATGGGATCGGTTGGACCAGTGACGGGTCCGTAATGCTGTTCACGG
ATTCGATCCAAAAGGTACGTCGTAAAGCCCCGATGTAACGACACCGGCTCGAAGCACTAACAGTATAGATTATCTGGGGC
TATGATTTTGACGCGGAAACTGGCTCATTATCAAATAAGCGGATTGTTGTCGATCTCAGTTCTGGGGATGGGGAGCCCGA
TGGGCTGCTGGTCGATACCGAGGATAACATATACAGCTTTCTCTGGGAGGGAAGTGGCGTGCATAAATACGACATGTCTG
GGAAGCTTGTCCAGCGATGGGACCTGAATGCATGGCGAGTCACACACGGGGCATGGATTGGAGCTGATCTTGACCAGCTG
ATGGTCGCAAGTGCCCTTACTGATGACAGGTCTGAGAAGTGGCCTGGAGAAGAAGGTGGCAGCCTGTTCAAAATTGTCAA
CCCAGGCGGCCGAGGGACGCCGAAGAACAAATTTGGACGTGCAGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62