GenePrediction:GLEAN_6837 Details

Name: GLEAN_6837
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1446367..1444545 (- strand)
Length: 1823
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1446367..1446355 (- strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_108:1446147..1444760 (- strand)
Length: 1388
Type: CDS
Source: GLEAN
Position: GCSC_108:1444706..1444545 (- strand)
Length: 162
>GLEAN_6837 class=GenePrediction position=GCSC_108:1446367..1444545 (- strand)
ATGCCCACAATTGGTGAGTTTTGCTTCCATTTTCGGCGCGGTGTGTACTCCGCCCGCTTTGACCCATTCCACTCCACAAT
TGGCGTTGCTTCTCCTGTCACTGACAGCGGCTGCCCTCATGAGCGACGCGCCTGTCCTGTTTTTGCTTAAATTATGCCTC
CACCCGACTCGTTATCAGCAACCGCTCACAACGGCTAACTATTGCAGCTAACAACCTCAGCGCGCCTCGTACATTGGATC
GGGACTCTCGCCATTCCCAGCATCGCCATGTCCGACGATAAGACACCGCCCACCGAGGCTCCGTCCCTGGTCGTCGACGC
TGGTCCTCTGGTTCGCCCCCCGGGATGGAAATACAAGGCCATCAAGATTGGCGGCGTTGAGCTGTGGTATGCCTCGCCTA
AAGTCCAGCTCTTCATGGTGGCCATGGTGTGCTTCCTGTGCCCTGGCATGTACAACGCCATCACCGGTATGGGCGCTGGA
GGGCAGGTCAACGCGCACGCGCAGGATAAGGCCTCCGTCGCACTTTACTCCGTCTTCTCCGTTGTCGGCTTCTTCTCCGG
CACCTTTGCCAATCGCCTCGGCCTGCGGCCGACGCTAGCTATCGGTGGCATCGGCTACTGCATCTATGCGTCCAGCTTCC
TGTGCTACTCGCACACTTCCAACAGCGGCTTCGTCATCTTCTCGGGTGCCCTCCTCGGCCTCTGCGCCGGCCTGCTCTGG
ACCGCTCAGGGCACCATCATGATGGCGTACCCGCCTGAGCGGCAGAAGGGCCGCTACATCAGCGTGTTCTGGATCATCTT
CAACCTAGGTGCCGTTATTGGCGCACTCATCCCCCTCGGCCAGAACATTCACGCCACAACTGCCAAGCCGGTGACCGATG
GCACGTACGCCGGCTTCATCGTCCTCATGTTCCTCGGTGCCCTCCTCGCTCTGACTCTCTGTGACGCTAACGACGTCATC
CGGGAAGACGGTACCAAGGTCATCCTGATGAAAAACCCATCCTGGAAGTCCGAGCTCATCGGCCTCAAAGACACATTGAC
TCAGGACCCGCTCGTGGTGCTGCTCTTCCCCATGATGTTTGCCTCCAACATCTTCTACACCTACCAGACCAACGATATGA
ACGCGGCTTTCTTCAATACCCGCACGCGCTCGCTCAACAACGTGCTCTACTGGGGCTCGCAGATCTTTGGTGCCATCATC
TTTGGTCATGCCCTTGATTACGCCCGAATACGCCGTTCTATCCGCGCCCGTGTTTCGTTTTGCATCCTCTTCGCCCTCAC
ATTTGCCATTTGGGGCGGTGGCTACGCCTGGGAGGAAAAGCAGTTGTCGCGCTCTTTGGCCACTACCGAAAACCCAAACT
ATGCGCCAATTGACTGGACCGCAGGTGGCAATAAGTACATCGGTCCCATGTTCCTCTACATGTTCTACGGTTTCTACGAC
GCCTGCTGGCAAACTTGCATTTACTGGTACATGGGTGCCCTTTCCAACTCCGGTCGCAAGGCAGCCAACCTGGCTGGCTT
TTACAAGGGCATCCAATCTGCCGGTGCCGCCATCTTCTGGCGTCTGGACGATAACGGAGTTGCCTTTAACAAGATCTACG
GCGCTACAGTATGTCCCCCCTAAATTGTTTTGAGGGGTTGTTCTTACTAACGCGTCCTTAGTGGGGCATTCTTGCTGGCT
CGCTTCTCATTGCCGCACCACTGATCGTGGCAAGGATCAGAGACACGGTGTCGATCGACGAAGACCTTAAGTTCTCAGAC
GAGACTATTGAGGATATCGTGGTCCCAGCAGCGCTTCACGAAAAGGGTGAGACTGGTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62