GenePrediction:GLEAN_6838 Details

Name: GLEAN_6838
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1443735..1439798 (- strand)
Length: 3938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1443735..1443646 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_108:1443052..1441833 (- strand)
Length: 1220
Type: CDS
Source: GLEAN
Position: GCSC_108:1441490..1439798 (- strand)
Length: 1693
>GLEAN_6838 class=GenePrediction position=GCSC_108:1443735..1439798 (- strand)
ATGCCTTCTCAGGGCTCGCCCATGCTAGCCAGGTCGGCAACGCAGCCACCGCAAACGCCCATCAATCTCGCCAAGCGAAC
TCTGCAGGAGGTGCGTGATCTGTGCCTTCATTTCCCAGGTTTTGGTTTTGGGCTGTTGGTTGACTTGAGCAGATGCAACA
GAACCCTTCTTCGACCACCAAAACGTCTCCAGCGGTGTCGGTATTGTCGCCCTCTGGCACCGTTTCGCCTTCGACCCCAA
ATACCACCATAATCCCCCCTTGGAAGCGCCAACGTTTGCGCGACATCGGTTCTAACGATACAATCAGCCGTGTGCATCAT
GCGTTTTCGCGTGTCTATGCTGGACGTATTGTTCGGGCGGACACAACAGACGTTGAGCTGGCGGTTTAGGATGCCGCCAC
CAATGCTGTCGTGTTCGAAGAAAAGGTGAAGAATATGTGCCAGAGCAGCAATGAGATACCCGACGGCTCTGCGTGCAAGC
CTGAAAGAAACCGTAACCCCCCAACCAAAGTTTGCGAGTTCTCCACCGTGTGGCCATTTCTCAGCAGTCGGCTTGGGCTC
GATGACGATACAAGTCTTGATAATAGCAGAGGAAAACGAACAATCTGGCTAGCTCTTCCCCCACCAAGCCACGGGGAGGT
AGCGATTCAGCATGCAAGACATCTCACGTCTGTTCTTCGCCAGGTCGATCACTATGGAGGGGTGCCACTCTACAAAAAAC
AGGCGAACTTGGCACCGCGGCTCTGGTTCACGCTGAGAGACCGCCAATTTGAGCAAGCTGCAGAGAATGAGCAGGAAACT
GACCAGGGTCATCCCATCATGCCCTCAATTGAGAGTTCCCTGTCCGACCAACCGGAAATGATTATCCCAAAGACAAATAT
ACCGGTGGCGAATCGGGCTTCCGCTATCTGCGAATCGCCAGTCGCTCTAATTCCTGTTGCACAGAGCCAAGCTGCCCAGA
GCCCGGCTGCCGGGGGCTTGGAAAGCAAAGAACCAATCGAGCAAAGAGAGGCAAAATCAGAAACAAATATATCATGTGAT
GACCTTGCCCCAGAAGAGTCTGAGAACGACTCATTCGGTCCGGTCACTCCACGAGCGCCGTCTACTCCAAAAAAGCGGAT
CAAGTCTCTCAAGCCAACCAAAGCACCGAAGTCTACCAAATCTCCAAAGCTGCCTAAGCCGACAGTAGCAGTAGGGACGG
CAGTCCCTCCATTCACACCTGTTCGCTCGGCACTGACACAGACGGAAACGATCGTGATTGAGGACGATGACGAAGGCAAC
AGCAGAAAGAACAGCGCTGCCGTGCCGGGGTCGTTGGAAGAGGCTGATGAGCTAAACGAGCTCATGGTGGAGACAGATCA
GGCCTTCCCACTGACTGTCAAGGAAGAGCATGAACTGTGGCTCCATGCCTGCCGCTTCTTTGGGCACGACGCCAGAGATT
GTGACCCACAGAACCCTGAACATCGGCATCGGGTTGTCGGCTTGAAGCTCACCTTGCGTCCAGACCAGATGTGGTCCGTG
TTCCGAATGCTGGCGGCAAGCGAGCTGACCGGCTTGCATGGTACGCTGCTGGCAGATGGCTTCGGGTTGGGCAAGACGCT
GCAGGCCACGGCCGTTGCAGTAGTGGCTGCACTGGTCCACATGGCGAAGTTGGAGGTGATGAAGGAATGGGCGGCTGACG
ATGACCGCCATCCATTTTGTCGCCGGCACTTGCCGCAGCCGAACAAAGGTCGGCCGCAGACTGAAGGCGCGGAGTGTCCC
TCCGGCACATACAGGCTTGGCTTTGCCTGTCCATGTGTGAAGCGCCTGCCTACAAATCGCTTGATGGATACTCTTCCGGG
GCCTGGAGCACTGTTTATCGTGCCTCCGAGCCTGCTGGCGCACTGGACAACGAAGTTGGCGGCGTATGTGGATCTTGACG
CGGTCGACATGTTTCCCCCAGGCGACAAAGATGAGGATGACGAAGACGAAGAAGACGACGAAGACGACGATGGACATGAT
CAAAATCTGATCGGAAAGACCCCCACGACGAGGCAAAGAAATGACCCTTTCTTCCAACTCGTCTGTGTGCGTGTCGGAGA
GTCAATTCACCGCATGACGCCGGACGTGCTCAAGCGATTTCTCATGGTCGATACAATATCTTCCAGGGTGCCGGCATGTG
CGCCAATACTCGCAACGGTGGTTCCAGTGGAGGGGAAAAAGAAAAAGGACGATACCAACAGCTACCATCTGTCCAGTCGA
TGCAGAGTGCCGTGTCCACTGGTGGTTGTGCCATCGTCTGTGGCGCTTGCGAACGCGTTCAAGATCGGCAGCACAATAGG
CCAGATCCAGCAAGCGCACGAGCGATACAATCCCGGGTTTCCACAGGCAGAAATGCGAGGTAGCATTTTGAAGACAGACG
TGGCGTTTCCCTTCCAGCCATCGATGGTGTTCATTGACGAGGCCCACAAAGTAAAGGGGAAAGACACGCTTCTCTGGAAG
ACAGTGCGGAAGATGGTCTGCCGGTCGCAGTATCCACTATTCGTGTATCCCTGCAGCGCTACACCGACACCCAAGGATCC
CAACGACCTAGAGTGCTTCGTGGACATCCTGGCCAGTCCGTACGGGAGTGGCGAGCTGCGGGCGTCGTTGCTGTCGTCGA
TTCCGTCATGGCTGCAGCGCCGCACTTTGAACCAAAAGAAGCTGGTAGACGCCTTACAGGCCTGGTACGCCCAGAGCCGG
TCACTGGTGTCCCAGGTGGAGGCCATGTCAAGAGAGGCGCATGATGAGTCGGCGACCGGACAACTGGTGCATGAAAAGCG
GCGCACTGATCTTCGGAAGCAGGCGGAGGTAGCTACAACTCGACGTCTGGCGCTGTTCAGGCTGGTAGCTGTGGCTCGGG
CGGGCGACCACGAGTTCCTGGGCAAGTTTCCCATTCAAAAGCTGCCACCGCTGGAAATTGAGGAGCGATTGTGTCCAACG
GACGAGAGCGTTCGTGATCTGGTCTCCGAGCTCAGCCGCAATGTTGCCGGTCAGATCCGAGAGCAGTACCACGAGTACGT
GCTGGCGGCACAGCAGAAGAAGCGACGTCACAAGAGGAAAGACAGCCCGGGTGACAACCGAATTCTCACGCTGGAGGAGT
TTGCGTCTCGAAGAAGCACCGACCGCGGGCCTCATGCAATCTTCTACGACCTCCAACTCTGTGCTGTATTTCCAGCACTC
GCCCGATATATGCAGATGTCGCCACCCCTCGTGGGACGTTACGGTCGAAAGTTTGAGTTCCGGACGCGCGACTTTGAGGG
GTTCCAGCAACCGCTGCCAAACGACAGTCAGAGCTGGACCAATACGCCCTACTGGCCACACATTGCGAATTTCTGCGCGT
ACAGCAGCAAGCTTTACACGTTGTACGGAATCTTGGACAGTATGCGGATCGACACCACACCGCACCGGCTGCTGTCAGGC
GCGAAAGTCGTACTGGCCAAGAGTGCAGTGGTGTTCACATCGCGGCCGTTGGTGGCATACACAGTGGCACTGGCGCTGCA
TCACCACTATGGCGGGCGGCTGCCGGTGTCGCTGGTGCTGGACACAACGAGCCAGCAAATGAGGCGTCAGTTGCTAGCCC
CGTTTGAGGGTCCTGTGGTGAAAGAGATGGCCAGCACCGACGATGCAGGCGTAAGCCGCGTGCTGATCGCAACCATTGGG
ACGTCAGCTGAGGGCCTGGATCTCACGCGAGCCAGCTATGCGTTTATCCTGGAGCCGTACTGGAACCACGACCAGGAGAG
GCAGGCGCTTGGTCGGGTGCTGAGAGCAGGTCAGTGCGCGCAAACGCACTTGTACAAGCTTGTATGTCCCGACAACATCG
CCGAGCGGCTGATACAATGTCGACAGATGGGTCGGCGGGCGGCAACTCAGGGATGGGACATGCAGGAGGCACTGGGATCG
TTTTTGCAGGAGAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62