GenePrediction:GLEAN_6840 Details

Name: GLEAN_6840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1433363..1431765 (- strand)
Length: 1599
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1433363..1433008 (- strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_108:1432947..1431842 (- strand)
Length: 1106
Type: CDS
Source: GLEAN
Position: GCSC_108:1431784..1431765 (- strand)
Length: 20
>GLEAN_6840 class=GenePrediction position=GCSC_108:1433363..1431765 (- strand)
ATGAAGTCTGCCGTTCTCCTCGCTGCCGCTTCCGCCCTGGTGTCTGGCGTCTCTGCGGCCGCTATCGAGAGGCCATCCAA
GGTGCTGCAGGCCCGCGCCACCACCATCTGCGGGCAGTGGGATTCCGTCGCCACCGGCGCCTACACCGTCTTCCAGGACC
TGTGGGGCGAGGCCCAGGGCACCGGCAGCCAGTGCACCACCATCGACAGCGTTGCCGATGACACCATTGCCTGGTCTACT
TCGTGGTCCTGGTCCGGCGGTTCCAACCAGGTCAAGTCGTATGCCAACGCCGTGGCCACCATTGCCAAGAAGCAGATCTC
GGCGATCAGCAAGATCCCCACCACCTGGAACTGGAGGTGAGTGCACCCTAGACGACTTCCCGTTCTTCCATTGTCCAATT
ACGCTAACCGCTTCAGCTACTCTGGGAGCAACATCGTCGCCGATGTCTCTTACGACTTGTTCACCTCCTCCACGGCCTCT
GGCTCGAACGAGTACGAAATCATGATCTGGCTCGCTGCCCTCGGTGGTGCTGGTCCCATCTCGTCCACCGGCTCCACCGT
TGCCACACCGACCATTGGTGGTGTCAGCTGGAAGCTCTACAGCGGCCCCAACGGCGACACTACCGTCTACAGCTTCGTTG
CCGCCACCGAGCAGACTAGCTTCTCCGGTGACCTGCGCGAATTCTTCACCTACCTCATCGCCAACGAGGGATTCCCTAGC
ACTCAGTTCCTGCTGAGCGTCGGTGCCGGCACCGAGCCCTTCACTGGCTCTGACGCCGTCCTGACCGTCTCGGCCTACAG
CCTCAGTGTCACCGACGGCACCGCTACCTCTGCTGTTTCTTCTGTGGCCGCCAGCACCGTCGCTGTCTCGACCAAGGCTG
TTACCACCGCCTCAGCCTCGACCAAGCCCTTGACCACCGGCTCCTCCCCGTTCAAGTTTGGCAGCAGCGGCCCGTTTGTC
GGCACCAACCACGCCGTCAACTCTTCTGCCGTCTTCTCCAACTTCACCACCGGCGTTGCCTCCTCGGCCGCCCGCACCCA
GCCGACTGTCTCTGCGGTTGCTGTCTCGGCTGCTCGCACTAAGCCGACTTCTTCGGCCGTCTCGTCTGCCAGCACGGAGC
CGACTGTCGCCGTTGTCACCTCGGCTGCTCGCACCAAGCCGACTTCCTCTGCGGTTGTCTCTTCTGTTAGCACGGAGCCG
ACTGTTGCCGTCGTCACCTCGGCCGCCCGCACCCAGCCGACTGTTTCTGCTGCTGTCTCGGCTGCCCGCACCCAGCCGAC
TACCTCTGCTGCCGTTTCGGCTGCCCGCACCCAGGCTACTGCCGTCTCTGCTGAGTCTGACTGCGAGAGTGCCTCTGTCA
CCGTCACCGTCACGGCTACACGGCCCCTATCCACCGCCGTGGCTACTGGCTTCGCTCAGACCAACGGCACCTTGGTCCCT
CACTACTACCAGTGCGGTGGCTCCAACTGGAACGGCTCGACCACCTGTGTCACCCCGTACACCTGCAAGCTGTGGAACCC
CTGTAAGTCACCCCCAGAATGGCCTCCCACTACTGATTTCACCTGCTGACCATCCACAGACTACGCCCAGTGCGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62