GenePrediction:GLEAN_6841 Details

Name: GLEAN_6841
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1430359..1429153 (- strand)
Length: 1207
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1430359..1430128 (- strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_108:1430039..1429870 (- strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_108:1429800..1429153 (- strand)
Length: 648
>GLEAN_6841 class=GenePrediction position=GCSC_108:1430359..1429153 (- strand)
ATGTTACTTGTCGCTGTTCGCGCGGTCCTGCTGCTATTGTTGACCGACCAAACGCAGACGGCGTATGCATCTGCCAAGTC
TGAATCCGGATCGCAGGTGATCCCAACCCAGCAAGCAGCAGTTTCTCAGAATGTGAAGTTCAACCTTCCCACACAGCGGA
CCTTTCTCCTCAACATCCCTAGCAGTTATGACAAAGAGACTGCCTATCCCTTGGTGCTGTCGTTTCACGGAGGTGAGTTT
CGATTGAAGTTGCAGTCGAGTCTCACGTTACTTCCAGACTCATCTGCCCGTCTGACACTTGCTTTTCGTACCTGTTCCAG
CCGGCGGCAACAGCAAAAAGCAGCAGCGTATCACCGAGCTGTCCGATCCATCGCTGCGCATTGCCGGGATGCCATTCCTG
ACGGCCTACGGCCAGGGCGTCAACAATACGGAATGGGGCATGAAGCACATCTGGAAGGGAGCCCCATACGAGAACAAGAC
TGTGGATGACGTGAGTCCTCGTCCTGGCCCTCTCTCCGCCCTCTGTTGTCCCGGCTGCTGACGCGGATCTTTGAGGAAGA
TTGCCTATGTACACGACATGATCGAGACCGTGGCTGCCAGCTACAACGTCGACCGTTCCCGCATCTACGCCTGCGGCAAG
TCCAACGGTGGCGGCTTCACGGCGCTGCTGGCCTGCCGACCCGACACGTCAGCTGTCATCGCGGCGTTTGCGCCCATCTC
GCCGGCCCTGTACCAGGGCACCTTTGCGTTTTACAACTGCTCGCCGGCCGGGCCGGCTCCCATCCTGCACGCCCACGGGG
TCGAGGATCGCATCACCGAGTTCCACGGCCGCACGCCGCTCGGCGGCTCGTTTGGCCCTGAGCCCGACGTCCGCATCTGG
CGTCGCGAATGGGCTGAGCGCAATGGCTGCCGCGCCGCGTCTTACCCGGGCGCCTATCCTCTGCCGGCCGTGAGCGAGGT
GCATCCGGGCGCCTGGGAGGAGGTTTGGGACTGTCCGGCTAGCGGCGAGGTGCGCGCGCTCACCGTCGAGGGTCTCGGCC
ATGCTTGGCCATCCACACTCGGCCTCGACCGCGCCGGCAAGCCCAACCAGACGGCCAACTTCAACTTCACCAGCCAGCAC
CTGGTGCAATTCTTCTCGCGACACCGGCTGGTCGTGTCCAAGGACGTTGAAAAGACGAGGGTAACAGAGAAACAGGAACT
GAAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62