GenePrediction:GLEAN_6842 Details

Name: GLEAN_6842
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1427958..1425751 (- strand)
Length: 2208
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1427958..1427600 (- strand)
Length: 359
Type: CDS
Source: GLEAN
Position: GCSC_108:1427530..1426250 (- strand)
Length: 1281
Type: CDS
Source: GLEAN
Position: GCSC_108:1426072..1425751 (- strand)
Length: 322
>GLEAN_6842 class=GenePrediction position=GCSC_108:1427958..1425751 (- strand)
ATGACGATAACGATGGCATCCTGGGACAGCCTCCCCGCAGAGCTGCGCCTCACAATTCTGGAGTACGTCGCCGGCGCAAA
CCCAAACTTCACAGACGCTGGACCTAGAGAAAGCTCAGCGCGGCACACGTACTACTGCGCTCCCTATGCGACCGTCTCGC
GCGACTGGCAGGTGTTTTTTGAGCGCCGCACCTTTGCGGCCATTGCGCTGTTCAACGACGACGTCCAGCCGTTTTGTGAT
GCCGTCGGACGCTGTGTCGACCGACTGGAGTATATAGGCCGGCTTCGGCTTACGATTGACCTGCCTGAGTACAGCTGCGG
CGAGTGCGAGACCGATGAAGACGCGGCAACCGTGAAGCGGTACGTTTATATTAATCAAGCATCAATCCTGTGTACTGGTG
TATCTGTTGCTAACATATCTTGCAGCAGCCATGTCGATTTTACACGTTACCTATGGCTTCTGTTACGCTCGCTTGCAGCG
TGGAAGATTCCAGGGCAGGAGGAACGGCAGCTGCTAAAGCGCAGTGACAAAATGTTTGCCCTTGGATCGTTTAACAGCGC
CGTGGGAATTCAGCTCGAGCTAGGTGTCCGTTCTATTAGCGATTCGCAGCACGCCTTCCGCGACTATCGCATCTACAATC
CATACGGAAACGTCCACCGCACTAGAGAAGACTTTCATCGGTATTACCGCGACGTTAGTGCCCAACAAGACTCCGCTACG
CACGGGTGGTTGCGCGGCGTCCGAAAGCTGTTGCCGCCACCTGTGGCTATCCGTCGTGTACTTGGTGCGCGTCTGCTAGA
GCTCGACGCAGACGGCCTAGGCGGCGAGACAAGGACAGAGACGGAGCGCAGCAAGCGGTATCTAGTGCGCCACGAACTGC
CAGCTGCTGCTATTGTAACCAAGCTCGTGTTTAGCCGCCAGTTTTACCGCGCCGTGCACCCGGCTACGCTGTCATACCTG
CTCCGCATCTGCTTTCCGCAAATCATGTATTTGCATCTAGAGCCGTGGAGGCCGGTAGATGCCGCAAACCTTGGCGCTAT
GGAACGCGGTTATTGTACGGTGCTGGCCAACCTACCACCATCTTTGATTGGTCTCTCTATTTTCTTAGAGACCAACTACA
TCATCCACCACCGCGACAAATATGCCGTGCATCCTGGCGCCACACTGACCGATCGCCGGCCGAGCCCACAAGTCGGACGC
CAGCTAGCAGAGGGCAGCGGCAGTCTTGTCGTGATCAGCGTGGCATTCCTTGCCGAGGCCGACGACTTTTTCGCAGCAGT
AGCGCGCATGCCCGCAAAGACCTGGCCGCGGCTCAAAACGATCGTCCTTACATCGTCTACGCTCACACCTGCATCCTCAC
CTGCCGACGTTGAGCAGCTACTGCTTGCAGCCGCAGCTGCGGCGGTCCGGATGCCGCGACTTCGGCAGGTCGAGCTCTGG
TTTGCCCGCGGCCCGCATGCATGCGCCTTTACGGTCACGGGAGCACGCTTAAGACTCCGAGCTACATGGAATGTAACTCG
GGCGCTCACGGCCGACGTGGTGCGCGCGTGGCGGGCCGTATGCCAAAATAAGACACATCGACATCTCCATGTAACAACCG
AGCTCTGGGCCTGCCCCAATAGCCAGACTAACATGGATGCGCGCATGTTGGTGCTTAATGGCGACGCACTTGTGAGGCTG
ATGATTCAAAAGGAGTCTCTCCTTGACATGTTGGTGGAAAAGGGTCCTATGTGGCGACATATGTAATAGCTTAATGACTA
CTCGCTTTGGCCCAAACGGTCTGCCACATACTCGTTGAGATCCAGGAAAGTGCTATGGAGTATGGGATGTTCATGCATTT
TCCTGCAGAGCTGGCACCATCAAGGTTCCTTCTTCTTTCGAAACAGGTGCATGCCTGGTACCCCGGCCAACAATGCTGTA
GAGGATGCGGAGGCTGGTTACATCCAGTGGGCCATAATGGCGACGGAAGAAGCAGAAAGTTGGGCGAGGGTGGCGGCAGC
AGCGAGCCTCGACGCCAGGAACGCTGCTATCTGGGCAGCGACTGTGGCGCCGTTCTCGATGGCGACGACCGACGCAGAAG
AGAAGGCGGATGAGGCGGAGGCTTCCTTGGAAAGGGTAGACGAGTTCGTGGCTGTGGCAGGAGAAGCCGTGCAGGTAGCA
ATGGCGAGGGCGTGGGACAATTGGGCGGAGTCCCAGGACGACTTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62