GenePrediction:GLEAN_6843 Details

Name: GLEAN_6843
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1380008..1378241 (- strand)
Length: 1768
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1380008..1379846 (- strand)
Length: 163
Type: CDS
Source: GLEAN
Position: GCSC_108:1379794..1379094 (- strand)
Length: 701
Type: CDS
Source: GLEAN
Position: GCSC_108:1378999..1378241 (- strand)
Length: 759
>GLEAN_6843 class=GenePrediction position=GCSC_108:1380008..1378241 (- strand)
ATGATAACTTCCAGTACAGAGGAGAGCTTTGACGCTCTCGTCGTAGGTGCAGGTTTTGGTGGCATATACCAGCTTTATTC
TCTGCGCCAACTGGGGCTTTCCGTCAAGCTCATCGATGTAGCCTCTGATGTTGGCGGAACTTGGTACTGGAATCGCTATC
CAGGTGCGTACAGTGTGTTTTCTGTGCCCTGGGTTCTGTCTGACATGTGTCCAGGAGCCATGAGCGATACGGAGAGTTTT
GTTTACCGGTACACCTGGGATGCTGAAGATCTTCAGACATACCCCTGGTCGCATCACTACGTCAAGCAGCCTGAAGTTCT
TGCCTACCTTAAGCATGTTGTCCAGCGCCATGACCTTCGGAAGCACATGCAGTTTAACACCAAGTTTCTATCGGCCGATT
GGTCCGAGGCCGAGAAGGTCTGGAACGTCGATGTGAGCACTGGGGCTCGATACAAGGTTCGCTACCTGATTACAGCCCTT
GGACTTCTTTCGCGACAGAACTATCCAGACATACCTGGGATCGATTCTTTTAGCGGAGTGAAGTGCCACACGTCGACTTG
GGATCCTAGCATCGATCTCAAAGACAAGAGAGTCGGTGTTATTGGCTGTGGCTCGACCGGTGTTCAGGTGATTACTGCGA
TTGCGGGCACCGTCCGAGAACTGGTGTGTTTTCAACGGCACCCGCAGTACAGTGTGCCAAGTGGCGACGGGCCTGTTAGT
CCTGAATACCGCGCTGAAATCAATGCAAACTACGACAAAATTGTTAAACAAAACCAGAGCTCGGCATATGGTTTTGGCTT
TGTGGAATCTGATCGGTCGTACGACTCCTTTTCACCAGAAGAACGGGAGCAGATGTTTGAGTCTCTGTGGAAGAGGGGAA
ATGGTTTTAGATTTTTTGGAAGTGGCTTCAGTGACGTGAGTGAACCAACAAAACTTTGGCTTCTTACTTTCATGCCAGCA
TCGCATACGTCGGGCACTATTGTTGTCACAAACTGACCAAGCTTCACAGTTATCCACAAACCGAGCAGCCAATGAAGCTG
CTTGCGAATTTATTAGGAAAAAGATCGCCCAGATTGTGAAAGATCCTGTCAAGGCACAGAAGTTGCAGCCTCATGAACCT
TATGCGCGCCGTCCTCTATGTGATGGGGGCTACTACGAAAAATTCAATCGCGACAATGTGTTTCTCGTTGACCTGAAGGA
GACGCCCATAGCAGCCATCACGCCGAAGGGTATCAAGACGAGTGATGGTAAGGAGCATGAACTGGATGTCATCATCTTCG
CCACCGGGTTTGACGCAGTCGATGGCCAGTATAAGACGCTGAATATCCGCGGGCAGGACGGCAAAAGTCTTAAGGAGCAC
TGGGAAAACGGTGCCACCAGTGTTCTGGGCACGAGCATTGCACATTTTCCCAATTTCTTCATCGTCGCAGGGCCCCAGAC
GGCCTTTTCTAGCATGCCTGTCCTCATTGAAGCTACTGTTGATTTTATCACTGGTGCCATCAAGCGAGCAGAAGAGCTAT
CCGTCAACGGAAAACAGGCCACCATCGAGGCAACGGAAGCCGCTGAAATCGAATGGACTAAAACCTGCAAGGACTTGGTA
GAGGGAAGCCTTTTCAAGGAGACAGACTCTTGGATCTTTGGGAGAAATATCCCGGGGAAGCCCTATTCTGTGACATTTTA
TTTTGGCGGGTTAGGGAGATTTCGCACGTTGATGCATAAGATGATCGAGGAGGGCTATCCTGGATACAAACCATTCTTAA
CATCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62