GenePrediction:GLEAN_6845 Details

Name: GLEAN_6845
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1361864..1360330 (- strand)
Length: 1535
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1361864..1361784 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_108:1361718..1361246 (- strand)
Length: 473
Type: CDS
Source: GLEAN
Position: GCSC_108:1361187..1361085 (- strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_108:1361031..1360330 (- strand)
Length: 702
>GLEAN_6845 class=GenePrediction position=GCSC_108:1361864..1360330 (- strand)
ATGGCCCCATTGAGCTTGTTGAAAGAACGATGTCATGGCTCGAACGGAGCGTTGAACGACGACGAGGTGTTCGATCCTGC
TGTAAGTACAAGGCTACGATACGATGCTGCGACGCGGCCAGAAGGAAGTCTCACACTCTACCCTAGGTGCATCTCGCCTA
CTCGCCGCCCAAGAAGCAGTTCACCATGCATGACCTGCTTCTAGAAAAGAGCGTGTCGGTTTCTCCCATCGCAGGGACCA
CGCCATTTCCACTTCTGTCGGACGAGGGCGTGCGAGCATATCGAAGAGCCCTGTTTCAGCAAAGGGTCATTGATCGATGT
GCTAGTTCACCGTTCCCAGGCACCCTGGTGCTCCGTGGCGCAGAGAAGCAGGCAAGATTCATCCGGGACTTCTGGACCCA
CCCCGAGACACTTCGCATCGTGTCTGAAGCCATGGACGTCCCGCTGGAGATCGTCATGCCTGCCGAGATCGGACACACGA
ACATCCAGGTCGAGGGAGCGACGAACCCAGAGATGGTAGGGAAGCTCAAGGTCGAGCCGTCAGCCGAGAAGGTAGAGCTG
AGCGAGGCCGAACGTGCCTACGATCCGCTGACGGATGCAAGCGCCATCATCCCATGGCAGTAAGGCGGCGATCATTTCTT
TGAGCGAGTTGTATCGCCATGACTGACCGGGCCACAGCCACGACTCGTATCCGTATGTCTGTGTCCTGATGCTGAGCGAA
ACCAGGGGCATGATTGGGGGCGAGACGTACATCCGAAAGGGCGACGGCACGGCCCAAAAGGTGCGTAGGGCTGTCCTGTG
CTGCACCCGTGCAGATCGCTGACAGCCGTGCAGGTCGAGGGGCCACGAATCGGCCACGCGGTGATGCTCCAGGGCGGCGA
GGTTGAGCACCTCGCAGCGCGTGCCCGGGGCGTGAAGGAGCGCATCTCGACGATCACGTCGTACCGATCCAGCGTACCGA
CGGTGTACGACTCGAGTTACATGACCAGCATCCGGCCGTACGCCGATCTCGACAGCCTGTATCCCGAGTGGGCGCAGTAC
CGGTTGCGAAAGCTGCGCGACGAGATCAACAACTACCTCGGTCAGATCGAACGGGATCCCGGCCGACCGCTGGACCGTGT
TGGTTTCGAGTGCCTCGTCGCCGCCCAGACCGAGTACCTGCGCCAGACATCACGTCAGATGATCGCGCCCCAGGAACAGC
ACCGCGTACTCCAGACGTACGGCAGCGCGGCGTATTATGATGCACCGCAGATCTGGGTCGCCGTCCAGATGCTGCCGTCG
TTTGAGCGGCTGGCCGCAGCCGCCGATCACAACCGCGTCTGGATGGCCGAGAGCGCCTGCTGGATGGACCTCCAGAACTC
GGCCGAGGCCCTCCGTCAAGGCCGGCCGCTCAAGAGCTCGCGTGGGCCTCTCGTCTGGCACGGTCGGCGGCAGTACTTTA
TGGGCGATGAGCTCATCCGTCAGGGCCTCAACGAACTCTTCCTCGACTGGCTCGGCGCGTCGGGGTTGTGGGATTTGTAC
TGCCAGGCGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62