GenePrediction:GLEAN_6849 Details

Name: GLEAN_6849
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1336664..1335751 (- strand)
Length: 914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1336664..1336541 (- strand)
Length: 124
Type: CDS
Source: GLEAN
Position: GCSC_108:1336475..1335751 (- strand)
Length: 725
>GLEAN_6849 class=GenePrediction position=GCSC_108:1336664..1335751 (- strand)
ATGAAACAAACAAGGCGCGAGCTCGATAACACTATTGACGACACGCTTACGGCAACTTTTTCGACAGTCCCCAACTTTTT
CTGCTTTTTTGACGGTTGTGATAAAGATTTTGCCATTTTCCAGGGTATGTAAGATACGATGTAAGACGAAGATACGAGAA
CAGCACACTAACGAGAACTACATATGCAGGCGTTGACCCTGACACGTTCTCCAAAATTGAGACTGGGCGGCAGCGCCGCG
GACGCAAGCTGCGTTTTCACTATCGTCCAGAGCAGCACCAGTTGCTCGTCACCGTCCCCAATTTTGAGCATGACACAGCA
ACTTGGACGATAAGCGCAGCTCTCTATCACGATCTGAACAATATGGGTCTATCCTATAACGACTTGGTGCCTTCGGGGAC
AACCAAGTTCGGCGACGGCGGCAGCGGGAAGGAGTGTGGCGAGGCTGACGCAGCCTTTATGCCTGGAGAACGTGCTGATG
CCCTGGATGGATGGCCGACGCTTGTGGTTGAGACGGGCTTGAGCCAGTCGTCTGAGAGCCTGGACGCTAAAATGCGTTGG
TGGTTTCATGCGTCGAACCATCAAGTGAACATTGTTTTACTTGTGAAACTACAACGGGCCTCGCACACTATCTGCGTCGA
AAAGTATGTTAAGGACATACCCCAACCGCGACAGGGGGCCACCTTCACCCGCTTCATGCCTGCGCTCGTCCCGCAATCAC
GTCAGAGCATTACAATCGCGCCCCATCCCAGGAGCCAACCTGTCGTATATGATGTTTTCGGCGGCCCGCTTGTCTTGGAG
TTCGTTTTGCTATTCCTGCGGCCAGCCGACTTGGCTCGGGGAGAACGGGATGTGGTATTGGATGCAACCAGGCTTGTCGA
CCTGGCTAGGCAGGTCTGGCGTCGGACATTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62