GenePrediction:GLEAN_6850 Details

Name: GLEAN_6850
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1333176..1331963 (- strand)
Length: 1214
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1333176..1333056 (- strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_108:1332916..1332354 (- strand)
Length: 563
Type: CDS
Source: GLEAN
Position: GCSC_108:1332289..1331963 (- strand)
Length: 327
>GLEAN_6850 class=GenePrediction position=GCSC_108:1333176..1331963 (- strand)
ATGGCGGCCATGCCCCCTGCCACGATTTACCCCCAGAGCCATGTTGGTTTCGACAGCATCACGTCTCAGATCGAGCGCAA
GCTGTTGAAGCGTGGCTTCCAGTTCAACGTCATTTGCGTTGGTGAGTGCCCTATCCAGGAACTCCTGATGCTGCAAAGCA
AAAGCGTGGCAGGGATCTCTGTCACAGGTCCTTAGCAGCTACACAACATTGTAGCTCTGTCCTCGACTGGACTGATGCTG
ACTCTGCTTCTGCTTCATAGGCCAGACCGGTCTGGGCAAGTCTACTCTCATCAACACCATCTTCGCCTCGCACCTTATTG
AGTCCAAAGGCCGATTGTTGCCCGAGGAGACCATCCGGTCGACTACCGAGATCCACGCTGTTTCGCACATTATCGAGGAG
AACGGAGTGCGGCTTCGCTTGAACATTGTCGACACCCCGGGGTACGGCGACCTGATTAACAACGATCGCTGCTGGGACCC
CATTGTCAAGTATATCAAGGACCAGCACTCTGCGTACCTGCGGAAAGAGCTCACGGCCCAGCGCGAGCGTTACATCCAGG
ACACGCGCATCCACTGCTGCCTTTTCTTCATTCAGCCGTCGGGGCACTCGCTGAAGCCCATCGACATTGTCGTCCTGAAG
AAGCTGTCTGATGTCGTCAATGTCGTGCCCGTCATTGCCAAGTCCGACTCTCTGACGCTGGAGGAGCGCCTGGCCTTCAA
GCAGAGCATCAAGGAGGAGTTCGCTTTCCACAACCTCAAGATGTACCCGTACGACAACGACGAGTTTGACGACGAGGAGC
GTGCGGTCAACACTCAGATTAAGGTAAGCATTGCTATACCTGACTCTTTACGTCCAGAGAGCATCCAACTGACGCGTCCC
CTTCCAGAGCTTGATCCCCTTCGCTGTCGTCGGCTCTGAGAAATCTATCATCATCAACGGCAAGCAGGTTCCCGCACGCC
AGAACCGGTGGGGCGTCATTAATGTTGAGGACGAGGAGCACTGCGAGTTTATCCACCTGCGCGACTTCCTGCTGCGCACC
CATCTGCAGGATCTCATCGAGACAACGTCACAGATCCACTACGAGACGTTCCGCGCCAAGCAGCTGCTGGCCCTGAAGGA
GAGCAGCGCTGGTCACACTAGCCGGCCCATTAGCCCTGTCGCCGAGCGTGAGATCAGCCGAAACTCCCAGCGGCAGACAA
TCAACGGCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62