GenePrediction:GLEAN_6852 Details

Name: GLEAN_6852
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1327249..1325043 (- strand)
Length: 2207
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1327249..1327091 (- strand)
Length: 159
Type: CDS
Source: GLEAN
Position: GCSC_108:1327013..1325561 (- strand)
Length: 1453
Type: CDS
Source: GLEAN
Position: GCSC_108:1325491..1325043 (- strand)
Length: 449
>GLEAN_6852 class=GenePrediction position=GCSC_108:1327249..1325043 (- strand)
ATGGCGACCGGGTCGGATGCAGGGCCGGTTGTGCCTGGAACAGCGACAGCCACTCTGCCAGCAGCGACAGCGGCTGCGGC
ACCTACGACGGGCGGCCTGGGGCGCGACGTGCACAACTCGCATGCGCTGGGCCGGACGCTCAACGCGCACGTGAAGCAGG
TAAGTCGGGATACGGCGACGACGAGTCCCTTCAATCGGGCTGGCTTGCTGACGCATTTTGTCCCGTTCTGGCACAGGCTC
GCGTCCTCATGGTGGGCGCCGGTGGCATCGGCTGCGAGCTGCTCAAGACGCTGGTGCTGACAGGCTTCGGCGAGGTCCAC
ATTGTCGACCTGGACACCATCGATCTAAGCAACCTGAACCGACAGTTCCTCTTCCGGCACGAGCACATCAAGAAGTCCAA
GGCGCTGGTGGCGCGTGACGCGGCGCAGCGCTTCAACCCACAGGTGCGGCTGGTGGCGCACCACGCCAACATCAAGGACG
CGCAGTTTGACGTGGCCTTTTTCCGCGGCTTTCGCATCGTCTTCAACGCGCTCGACAACCTGGACGCCCGGCGGCACGTG
AACCGCATGTGTCTGGCCGCCGACGTGCCGCTGGTCGAGAGCGGCACCACCGGCTTCAACGGCCAGGTGCAGGTTATCCG
TCGCGGCGTCACGGCCTGCTACGACTGCAGCCCCAAGGAGGCGCCACGCTCGTTTCCCGTCTGCACTATCCGCAGCACGC
CCAGCCAGCCGATCCACTGCATCGTCTGGGCCAAGAGCTACCTGCTGAACGAGATGTTTGGCGACAGCGAGGACGAATCG
GCCTTTGACCACTCGGCCGACGCCCAGAATGCTGCCGAGATCGTCGAGCTGCGCAAGGAGTCTTTTGCCCTCAAGGCGCT
GCGCCGTGCTGTCGGAACCCCGGCCTTTGCCCGTCGGCTGTCCGACAAGGTCTTCCGCGCCGACATCGACCGTCTGCGAT
CCATGGAGGATATGTGGAAGTCACGTGACCCGCCCCAGGTCCTGGCCTATGACGACATCGTGGCCGCGACGGCTGCGGCT
GGCCTAGGACCAAACAACCCCGAGGCCGTGGCCGTTCTGCTGCGCGACGGCCAAAAGGTCTGGACGCTCGAGGAGAGCGT
CGTGGTATTCAACGACAGCATTGAGCGGCTCAGCCGCCGTGTAGCCCAGCTGCGCGAAGCCGGCAACGCCGACGCCGACG
CGCTGATCGAGTTTGACAAGGACGACATCGACACCCTCGACTTTGTGGCCGCCAGCGCCAACATTCGGTCCACGCTGTTC
GGAATTGAGCACCGGTCGCGCTTCGACATTAAGCAGATGGCGGGCAACATCATCCCGGCCATTGCCACAACCAATGCCAT
CGTCGCCAGTCTCTGCGTCCTGCAGTCTTTCAAGGTTCTGCAGGGCGATTATGACGCCGTGAAAGAGGTCTTCCTCACTC
CCTTCGCCTCGGACCATCTCCTAGCGGCCGACCAGCCGCGCCAGCCGAACCCCGAGTGTCCCGTCTGCAGCTCGTACCAG
ACGAGCGTCCGCGCAGACCTGTCCAAGGCAACGCTGGCTGACGTGGTCGAGCTCATCGTCAAGACACAGCTCGGCTTTGG
CGACCGCGATTTTGTCGTCAGCAATGACGTCGGCATCCTGTACGACGTCGAGGAGACAGACAACCTGGAGAAGCAGTTGA
GCGACCTGGGTACGTCGATCTGTCCATCTTTGCGGTCAATTCACTATTCTTCTCTGTCTTATTAACAACGTTTTGCAGGC
GTTCGACCTGGCAGCTTCCTCACGGTGATCGACGACGAGGACGAGGACCCCTATGTCAACGTGGTCATCAACATCGAGGA
CAGCAAGGGGGAGCCGCTTCCGGACGGAAACCCTGTCGTTGCTGTCGGCCTCGAAGGTCCGCCCAACATTCGTCGGCGGC
CTAAGAAGACGACGCCTCCCTCTCCTCCCCCATTAGCGGAGGCCAACGGCACGGCCAAGCAAAACGGAAAACACGCGCTT
GACATAGACGATGACGATGTCGTTCCCTTGGACGGCCCGGCGCCCAAACGGCCGCGAGTGGACGATGTTGTCCCCGCCAG
CAATGGCAACGGCGAGTCGGCAGCAAAAAAAAAGGCAAAGCCCGGCGAGGACGTCCCTGCTAGCAACGACGACATTATAA
ATATCGAAGACGTGTCGAATGGCGCCATAGTCATTGACGACGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62