GenePrediction:GLEAN_6853 Details

Name: GLEAN_6853
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1323260..1321070 (- strand)
Length: 2191
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1323260..1322876 (- strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_108:1322331..1322179 (- strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_108:1322109..1321070 (- strand)
Length: 1040
>GLEAN_6853 class=GenePrediction position=GCSC_108:1323260..1321070 (- strand)
ATGGCGACTGCAGCAGCAGCCGCGGTCTCGTTTCGGGCAGCGGTGCCGTCAACAAGCCTGGTGGCCCGGCTTGCCTCTGC
CTCGGCGACGGTGATGCCGTCACAACCGCGCCGGCTGGCGTCGCTGTTTGCGAGCCAGCTAGCGGCCATTCCCCTGCTGT
CGGCGATGCCGGCCATCTCTCTGTCGCTGCCATCACTGCCGTCGCTGCTCGGCGACATCTGGGAATCGATCCTGCGGGCG
GTGCCCAAGAAGAAGACGTCGCACATGAAGAAGCGACATCGGCAGATGGCCGGCAAGGCACTCAAGGACGTCAACTCCCT
GTGCAAGTGCCCGGCGTGTGGCCGGACGAAGCGGATGCACTACCTGTGCCCATACTGCATGGAATGTGCGTGACGTCTTT
GCTGTCTCCTTGTTCCCGGTCGTGTCTGTGATGTGTGAATTCCTGCTGACAGTCGCAGCATTACGAGAGATGATGAAGAA
GAAGTTATAGTGCTCTTGGCCACGAGCTCATCCTGCCGGACAGCCCGGCTCACGACGGACGTAAGAAACCCAGATGGTGG
AAGGCTGCAAGACAGCGCAATTGAGCAAGAGTTGTCCGTACACAGAAGCTGTGGACAATCCCCCATGTACAGTAGTAAAG
CATATAGGAAAAAGTATAAAATATATCAACTAAGCGTTTCGATGTCAAATGGGGTGAGGCTGCAGCTTGCTCTCCAGAAA
GAGCTGCAGCTGGTGCTTTCTATGTGCGACTTAAAAAAGCCTCTACGATTGAGACAAACAGTAAAGAAACGACAGTGATG
GCTTGTGGTGGCAATCGTGACTGCCGTTGGTTGAAAGAGCAGCAGCGGAAAGAGCTATCAAGGCTGTGACCCCACATCAA
AATTTCCCCAGCAGGAAGAGAGAGCTTCCCAGGCTCTCAACCCAACTAGCTGCAGACGGGCAAATATCGCGTCGACATCA
GTTCCACCAGAAGCCGCCATGGTTCGTTCCAAGCTCCAGTTGGGGACATCTTTTTGTCGAGTTCTCTGCTAAGTTTCTGT
TGCAGTCGAAGCAATACTACATTGCGCGGGCGGTGGAGAATGGTGAGTCTGCGAAGCCCCGCCAAGGCATTGAAAGCGCG
GATCTGCGAGTCTGACCTCTCTCTGCTGCAGCACACGAGACGGACATTTTTTCCGTTGCGGTGACGCAGCACGCCGTGAT
CTCGGGCTCAGGCGGCTCGACGCTGCGGGTGCACAGCACGGACTCGGCGGAGTATCCGATTGTGCAGTCGATAGACGGAG
CGCACAAGCTGGGCTGTCACCACGTGGCGACAGGGCGAGGAGGATCTGGCCGGGTGGCCTGTTCGGCCGGCTTTGGGGGG
GAGGTGCAGCTGTGGCGGCTGAGCGAGGCAGGTGACTGGAGTCTGCAGACGCAGCTACGGCCGAGTGATCTAGGGAGTGG
TGGCAGTGGAAACGGTGCACCCACCGGCGATGCCTGGGCGCTGGCCCTCAGCCACGACGAACAGTATCTCGCATACACGA
CACACGATGGCCGTGTGGGCGTATGGGATCTTGCGGCCGGCAGTCGGCTGCTGGTGTACAGCGCGCACAACCGGGCGACG
AGCAGCTTCGCCATGTCCGTCGACCTCAGCCAAGACGGCCGCTACACGGCCGTGGGTTACCAGAGTGGTGCCGTCAATGT
GTTTGACAACGACGCGTCCAAGCTGGTGCACGCGCTGCCGGGTCTTGCACGACCGGTGCGTGCCGTCGCTTTTTCACCAC
TGGGCCGCCGCCTGGCTGCTGCTGGCGATGCTGGTGTCATCGCCATCTACGACATGAAGCACGGCGAGCCGGTGGCCAAT
TTGACACCACCGGGCGGATCAGCTTCGATGGCAACGTCTGGCTCTGGCTCCTCTGGGCCGTCTGCACCGTCGGATGTCCT
CTCCTCTGTCTGGGTCATGTCGCTCGACTTTTCTGCGGGCGGCGAGCACCTCCTGGCCGGCTACATGGACGGCAAGGTGC
GCGTTTGGAATGTCGAGCTGGGCACGTGTGTGGCTACCTGTGGTGATGCCGAGATGGCCACGCTCTGGAGCGTCCGGTGG
CTGCCACCACGCTCCGACCGACCCGGCGCTGACACCGAGAGCTTCTGCACCGCCGGGGCCGACCGCAGACTCACTTTTTA
CCGCGAAGCAGGGTCGAATTCGATTATTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62