GenePrediction:GLEAN_6854 Details

Name: GLEAN_6854
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1309395..1306728 (- strand)
Length: 2668
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1309395..1309291 (- strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_108:1309235..1308641 (- strand)
Length: 595
Type: CDS
Source: GLEAN
Position: GCSC_108:1308581..1307092 (- strand)
Length: 1490
Type: CDS
Source: GLEAN
Position: GCSC_108:1307038..1306870 (- strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_108:1306765..1306728 (- strand)
Length: 38
>GLEAN_6854 class=GenePrediction position=GCSC_108:1309395..1306728 (- strand)
ATGACGTCTAGCTACCAGTGGCCTACCTTCTTCATCGGACAGCATGACGCTGGAAGGCAGGAACCCCTTGACGACAAGCA
GTATGGCTATCTTCTAGACGCTGGGGTGTGTTTTTGGCGTCCCTTCCTGTTGGCTGAGCAGTCGGGCTAACCAGATGCAG
TTTTCCTTTGCCACGGCACCCATCACAAACAGTCATTTCCACGACCGCGTCCGCAAGCTCCACAAGAGCTACCTTGATGA
TGTCAAGGCCCGCAACCTGACGGATGCGGAGCGGGCAAACCCATCGTTCCCAGGCCCCACAATCTCTACGCTGACTGACG
ATGACACCGGCCTGTTCCCAGGTCGCTACATCACGTCTGTCATTGCTTGCTCCAGTGCATGGATCGACCTGTACTCGGAC
GACCCTCTGGTGGCCAACCTGTCCCGCCAGGTCCTCAACCTGGAGGTTGCCTATGCTAGTTTCTGCGGTGTCAGGAGCAT
TATCGTACCCGGCCCACGGGCCGACAGCAGTGGCAAGCACGTGGCTCAGTATGCACGCGCAATCCAGGAAGCCCTCCAAG
TAGCCAATCGGGCCTCTCTGGTCATCCAGGTGCCCATGTACCGCGAGCCCGGCCTGGAGGAGAGCATCGAGACCCTTTCG
GGACCTGGTGCCTACCCAGAGGCAACAGCAGACCAGGAGATTGACATCTACGGCTGCTGGGATTCGTGGCACACCATTCG
GACCGTCTGCGACTACAACTCGCGCCTGTCGGTTGGTAAGCTGCGACTTCTTTGAATTGACAACGCTCAGCCAAGGCTAA
TATGAGGCATACAGCCATCCGTATTCCCCGGAGATTGCCCGAGATCGAGCTGCAGTCGCGCTGGTTTGCCGAGCCGCTGC
AGATCCTCACCTTTGACGCGGCCATCTTCCAGCTGAACGCCTCTGGATTTCCCAGCCTCGGCAAGAGCCACAAGGAGATG
CTCAACCGGTACATGCGGCTGAAGATGGCACCTTGGATGCTTGTCAGCAACGGCGGGCCAGACGTCAAGGAGCTCGCAGC
AGCAGCTAGCAGCAACGGCAGCAACGGCATCACCCTGTCGCCCAACGCGGCCGAGTTTCTCACGCTAGCTGAGGCCCGCG
GCTCGCCGGCAGCCAAGCAGAAGAAGCAGGGCAGCAACGATTACCTCTCCTACCTCAAGTACCTCGAACGGTCGCAGGAG
CCGTACTCGGAGACCGAGACGTCTACACTGACCAGCTTCCAGGACTGGCTTCAGTCGCCGCTTCAGCCACTGGCTGACAA
TCTCGAGTCGGCCACATACGAGGTCTTTGAGGGCGACCCGGTTAAGTACGTGCAGTACGAGAAGGCCATAACTGCCGCCA
TGGCTGACTGGAAGGCGCTGAAGCGGCCGACTTCGGCGATCCCGCGGCCCGGCCAGACAGAGTCAGCTACGTCGACACCA
GAGCTCGTGGTGGCCGTCGCAGGAGCCGGCCGAGGCCCGCTGGTGACGCGGGTGATCCGGGCTAGCCAGGCCACGGGCGT
TCCGGTGCAGCTGTGGGCGCTGGAGAAGAATCAGAACGCGTACGTTTACCTGCTGCGGATGAACAAGCAGGTCTGGGGTG
GCAAGGTGCACCTGATCAAGACGGACATGCGTGAATGGGCCGGACCGGTAGCCGAGGGCCACGAGGCCACAGGCACGACG
ACCAAGGTGGACATTCTGGTGTCGGAGTTGCTGGGCTCATTTGGCGACAACGAGCTGTCGCCCGAGTGCATCGACGGCAT
CCAGCGGCACATTGCACGGCCACACGGCATTTCGATCCCGCAGTCGTACACGGCACACCTGAGCCCGATCTCGTATCCGC
GCGTCTATGCGGACTTGGCGAACCGCTCGGTCGCAGACGAGAACGCCTTTGAGACCCCCTGGGTCGTCCACCTGTTTGCC
ATCGACCTGGTGTCGCAAAAGGTTCCGGGCCGCCCACGCTTCCAGGAGGCCTGGGAGTTTGTCCACCCAGTGCGGCTGCC
GGTCGTCGAAGACTGGGAGGCTGCACATGGCCGCAAGAAGGTCCAAACTGGCGGTGGCGGTGCCATGACCCTCTCGGCAG
GCCTCAACGAGCACAACGCCCGCCACTGCCACCTGACGTTTGTTTGTCGCCCGCGTGGCGTCATTCACGGTCTGGCCGGC
TACTTTGAGTCGGTGCTGTACCAGCCGGCAGCCCAGGACGGTGGCCCAGCTCCAGTACCCATCGAGATCAGCACGCGGCC
AGACCGCATCGACCAGAAGAGCAAGGACATGATTTCGTGGTTTCCCATATTTTTTCCGCTCAAGGTGAGGCCAACCATTT
TCGCCTGTACACTACCTACCCCACTGACATGTCCCAGAAACCAATGTACTTTCCCCAAGACGCCGAGATCGAGGCCAGCA
TGTGGCGCCAGACAGACGACACCAAAGTATGGTACGAGTGGTTGGTGGAGGCTTATGTTTGGGTTGGACCGACGACACGG
GTCAAGGTGGCCACGTCAGAGCTCCAGAGCAGCAGGAAGGTTGCCTGTCTAATGTAGTTGCTCAGTCTGTGAGCAGACGT
TAAAATGGATCAACAGACTGGAATATAAAAAAAGGCGATGCTGGGATCGACAACATCTCGTTTCGAACAGTCCCGCTGTC
CGTGTTTAGTGCCATGATGTTCGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62