GenePrediction:GLEAN_6855 Details

Name: GLEAN_6855
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1305874..1303569 (- strand)
Length: 2306
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1305874..1305718 (- strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_108:1305656..1305165 (- strand)
Length: 492
Type: CDS
Source: GLEAN
Position: GCSC_108:1305104..1304507 (- strand)
Length: 598
Type: CDS
Source: GLEAN
Position: GCSC_108:1304447..1304103 (- strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_108:1304043..1303569 (- strand)
Length: 475
>GLEAN_6855 class=GenePrediction position=GCSC_108:1305874..1303569 (- strand)
ATGCTCCGAGACGTCTCGTACACATTGGATCGCTGTGAGCGCGAATGCTTGAAGACTGTCTTTGACGAGCTCATGAAACA
CGTCTTGATTGAGGCCTTTATGGATCTTGTGAAATTGTGGACAGGTCTGATCAAATATATGCGAGACAATCCACAAAGTA
AGTTCGGCACTGGTATTCGTCTACTGAGCGTCTACTGACAGCACTATTGTCGTAACAGAAGCCGATACCATCTCATCTAT
GCTCGCTGACACCCCTGGAAAGGTCGAGAAATCGTTTGCCCACCTCAAAGCCATCGCTTCTACAAGTTTTGGATCGGAAT
TGCGGCGAGCCCCCACTCTCTCGGAGCCTCTTCCAGACAGTATAGCCCTCCCGTGCGGCGGAGCACCGTATCATGACAGC
AGAAAGTTTATTGGTCGCGAGAATGAGATTGACGTCATCCACGGAGAACTCGGTCCAGCAAACATGAAGGATCAGAGGTT
CTGCACCATCTGGGGCCTCGCTGGAATGGGAAAGTCCAAATTGGCGATGGAGTATGCGAAACGCTACGAGGGCGACTTTT
ATGCCACTCTCTGGATAAGTGCACAAAACGTAATATCCATAGGTCAGAGCTTCACAAACATTGCCATCGATTTTGGGCTG
CAAAAGGCGACGAACGGCGGAAAGGTCGATGATAACATACGGTTGGTATTCAATGCTATCAAGAAGCGCGGTTCGTCAAT
CTCATGACCTCTTGATTTCTAGTTTGTTGGCTGATGTGTGACGATAACAGGCGGCAACTGGCTCATTATTTGGGACGACG
TCAAAGAACAAGCAACAATAAGGCCACACCTGACGCTAAACTCCAAGAGAGTCTCGACCCTCGTCACCACCAGATATCCT
GAAGAGGCGGCAGTTTTCAGATCACGAGGAACTCTTTTGCATCTTAAAAAGCTGTCCATGGACACCTCGACAGAACTCTT
CGAACGGCTTCTGGGTCCAGACAATCGCTACCCTGAAGGATCGGAGGATTCGAGAGCTGCTCATGTCATTCTTCAAAAAA
TGGACGGTCACCCTCTCGGCATATGCACCATGGCAACTCGTATTGTCGCAAAAAATCTGTCTGCCCGAGGCTTCCTCATG
CGCTACCGACGAGACAATATTCCCGTCGTCCCAGAACTGGCAGATTACGAAATTGCGCTGGAGGCAATCTGGAACGAATC
TTTCCAGTACCTCAAGGATATGAAGGAGAGTAGAAATGGCGACTGTTTTGACTTGCTTGGAGTACTGTCTTTCTGCTTCC
CTGATGCGATTCCAAAGACGCTTTTTGCGACTGAGCAGCCCGATGACTCGGAAGGCGTCACTCCGATATTCCACGACAAA
CAAAACAGGTTAGTTTTGCGCTTACTGTGCGTATTTCGTTTCCACTTCCTTACGCTGCAAAAATCAGATACGAAGAGGCA
TGTGAGATGCTTCGAAAGTCTGGTCTCATAGACTACGACAAGGACTACACGTCTATCACCATGCACCGGGTGACCCAAGG
TGCCTTTCTCGCCTTTCTGGGCCCCGAAGCTATCCAGTCCTCTTTTTGCCTTGCAGCCAGCTTGATACATCGGGCTTTCC
CCAAGCAAGTCGAAGGCCGGTCCCTCCATCTTCAATGGGATGACTGCCGTACCTACATACAGCACAGCAACAAACTGATC
AAAGTATACACGGAATCAAGGCTGCCTCATCGTCGGTATCAGCCGCTGCAGCCGTGCGAAGACTTTCTTGAGCTCATGGC
TAATGTTTGCTGGTAAGAACAAACTACGTAAGGATGGAACAGAATTCTCTTACGAATCTAACGTTTTCTAGGTACCTTGT
CGAAAGTGGCCAAGACTCTGAGTGCCAGCGTCTATCCGAAATTGCACTAAAGGCCGTCGGGCCCAATACCTATCGTTACG
CGCATTTAAACAACTCGCTCTTTGCCATGTCTTGGTTTCAGAACGATCTGAAGAGTGCGTTTAAATATTGTGGTATCGCT
GCTTCTTCGATGAAGGCCCACAGACCCGAGACATCGGAGGAGTATCTAGGAATACTTTCCAACAAAGCCAGCTTGTTGGC
GTCGGATGGAAAAGATACAGAGGCCCTAAAGCTCTACCTTGAGGTGGAAGAGACTCGTAAGAGGTACAATTATCCCCAAA
ATATCGCCCTCGCCTTTATCAATCTTGGGATTGGTCGTTTGAAGAGCAAAATGGGCGAGTTCGACGATGCTGCAACAAGA
CTCGAGGCGGCTCGAAGTATAGTACAACACGAGCATGGACCGCACGGAAAATACATGCAGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62