GenePrediction:GLEAN_6856 Details

Name: GLEAN_6856
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1295492..1293825 (- strand)
Length: 1668
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1295492..1295130 (- strand)
Length: 363
Type: CDS
Source: GLEAN
Position: GCSC_108:1295062..1294607 (- strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_108:1294511..1294265 (- strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_108:1294198..1293825 (- strand)
Length: 374
>GLEAN_6856 class=GenePrediction position=GCSC_108:1295492..1293825 (- strand)
ATGCTGCAAGAGCTTCTGGCACAAGGCATTTCCAGCATTGATCTGATTGACGTTTACCTCAGGCAAATTGAGTGCCATAA
CAAGAATGGCTTCAAACTGAATGCAATTATTTCCACGGCGCCTCGGCGAATCCTCGAAGAACGGGCCGAGATGCTCGATA
CAGAGCGAGCGAACGGCCATATCCGGGGTCCGTTGCATGGGATTCCTATTGTTGTCAAAGACAATATAATGACAGACAGT
TCACTTGGCATGGACACAACCTGCGGATCCTACGCGCTAGTAGGTGCCAAAGCAAAGAACGCACCCATTATCAGCCGTCT
GCTGGCGGCAGGTGTGATAATTCTGGCCAAGGCAAACCTCTCTGTGAGTGAATAAGGGGCACTTGCATGTCGTCCAGCTT
CATAGTTGCTAATTTGTCCTTTTCCCCCAGGAATGGGCGGGCTCCAAAGGATATGGGATAGCGACGGGGTGGTCGGCCAT
CGGTGGCCAGACACAGACACCGTATGTGCTCGGTGGGTATGTTTTGGGAGACAAGATCCTAGGCCACAGCGCTCCAGGAG
GTTCGTCTTCGGGTTCTGCTGTAGCTGTGGCCGCCGGTTTCGCCCCTCTGGCTCTGGGGACAGAGTCTGATGGCTCCATC
ACACAACCGTCTGGAAGGTCCTCTCTTTACGGAATGAAGGTGACTGTTGGTGCCTTGAGCACACAGGGCACGTCACCACA
ATCTCCTCTGACCGACAGCCTTGGTGGCATGGCCAAGACCTCACAAGACCTTGCCGATTTGATCGGCGCAATGATGGAGA
CGAGCTACTCCGCCTTCCTGACTGGGTCCTGGGAAGGCCAGAAAGTTGCATTTGTGGAACCAGAAGCATGGGAGCTTCAT
CCGGCCGTATGTGCCAGGGAAGACAGTGTCCGGAATAAACAGGTAGGAGTCCCTTGCATCGCTATCGAGGCCACGGCACT
TTTCTGACAAGAGAAACTTAGTTGCGAGAAATGAAAGACGTAGCCAAGAAAATCCAGGCACAGCAGGCGGCAGTGACGGA
AGGCGTGGTTCTGCTGCAGGCGGATGAGATCAGCCACAACGGTAAAGATGCCCTAGAGCTAGTCTGGAACTTTGATCTGG
CCGGAGGGATAGATTCATTCCTTGGTGAATATACTGAATCTGAAGTGCGAACTGCCGAGCAGCTGATCCAATGGAACAAA
GAACATATGGATCTAGAGTTGCCGCCAGGTAAGAGCTCCTGTCATTGGCGTCTCACTCGAAGGATTGGCTTACCCACTGC
TGATTTGATGACAGAGTTTCCAGCACAGCAGCAATTGGAGAATACGGTGAAATGCAAGCTGACACAAGAGGAGAGAGACG
CCATAGCTGAATTCATTCGCCACAAGGCCCGGAACGCTTTTGACCGGATTCTTGGAGAAGGTAAGGCCACGGTTCTGATG
GGGCCTCTGGATGGCCGCATCGTCACAATTGCTGCAGCTGCAGGTTATCCAGCCGGCGTGGTACCGCTGGGATATGCAGA
TAACTTTAATGGCAGGGCGTACGGCATGGTTATTGTTGCCAAAGCAGGCGGCGAAGGTGATATTTTAAGGGCTATGAGTG
CATGGGAGAGTAACGCGATAGGAAAGCGAGTGGCACCTCCGCTGCTCGCCAACAAGGCGGAATTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62