GenePrediction:GLEAN_6857 Details

Name: GLEAN_6857
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1293232..1290295 (- strand)
Length: 2938
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1293232..1292128 (- strand)
Length: 1105
Type: CDS
Source: GLEAN
Position: GCSC_108:1292066..1292025 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_108:1291966..1291932 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_108:1291872..1291574 (- strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_108:1291519..1291377 (- strand)
Length: 143
Type: CDS
Source: GLEAN
Position: GCSC_108:1291315..1291059 (- strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_108:1290981..1290903 (- strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_108:1290845..1290295 (- strand)
Length: 551
>GLEAN_6857 class=GenePrediction position=GCSC_108:1293232..1290295 (- strand)
ATGGATTTGCGAGGCAATCTCTTTGGCAACAAAGCCCGTGGCGGCGGGCTTCCCGGACGTCCAGGCGGCGGCGCACCACC
ACCGCCCGGCTACGATGGAGGAACACGGGGCTACGGGGCGCCGCAGCAACGGGCACCAGTCGGCAATTATGGAAGGGCCC
CTCAACAGGCGCCGACACAGATGCAGCAACCGCCACAACAAGGGTATGGGGGTGGCGTGCGATTGCGGCTGGCCAAGGTG
GACGACAAGACGCTGCAGCAGGTATACATCTTCACCAACGTGTGTGCGGTGTCGCCGCGGGACTTTCCACCGTCGCGCGA
TGGATCGGACCTGTATCTGCGGCTGACGGGAAACATGCTGGACGGCGACTTTGTGGTGACGGCACGGCCGACACCGGGAT
TTCCTGACGGCTGCATTGCTCTGTCAGACCCACAGCGGACGTGGCTGCGGGTGGGCATGATGGACGAGCTGATCGGCGAG
GTGTACAGCCCGTTTGCTGCAGGCGGCAGCCAGGCGTATCTGGGCACGATGGACGTCGAGATCGGATTTGCGTCGGCCAA
GAAGGTGACGGACACGACGTACGACCAGGACGCGCTGGCCGACGTGATGACCAAGACGTTTGCCAACCAGATCTTTGCGC
CGGGTCAGCGGCTGCTGTTGGACGTGCACAACATGCCGCTTTCGCTGGTCATCAAGACGGTCCAGCTGGCCGACCTGAGC
ATGGAAAAGGCCAGCGGAGCGGCGGCGGCGGCGGCTGGCGCAGCCACGCGCACAGATCCGGGTGCCCGTGGCATCCTGGT
GCCGCAGACGGCCATCTCGTTCTACAAGAACGCCGGCTCGCCGATCAAGCTGTCCGGGTCGACGAAGCGGGCGGCCGCCA
ACTCGATCATTGCGCCCGACTTCAAGTTCGAGGACATGGGCATCGGCGGCCTCGACAACGAGTTCTCGACCATCTTCCGT
CGCGCCTTTGCGTCGCGCATCTTCCCGCCCGGCTTGATCGAGAAACTGGGCGTACTGCACGTCAAGGGCATCCTGTTATA
CGGGCCGCCGGGCACGGGCAAGACGCTCATTGCGCGCCAGATCGGCAAGATGCTGAATGCACGAGGTACGTGTGCAACAG
CTGTCTGGGAAAAATTGGGTTTGCTGGGCGATATTGACTGGCGCAGAGCCCAAGGTGATCAACGGACCGGAGGTGCTGAA
CAAATATGGTACGTGGACACGAGAGACACTGGCGATCAGCTAGTTTCATATCTGACAGCAGCGCAGTCGGTCAGAGCGAG
GAGAACATCCGAAAATTATTTGTAAGACCCAGGCGCGTGCGCGTTCAAAGACAGGCAGATCCGTGCTGACGATGGGATAG
GCCGATGCCGAGAAGGAATACAAGGAAAAGGGAGACGAGTCGCAGCTGCACGTGATCATCTTCGACGAGCTGGACGCGGT
GTGCAAGCAGAGAGGCTCGGGAAGCGGTGGCACAGGTGTGGGCGACAGCGTCGTGAACCAGCTTCTGAGTAAGCTAGACG
GTGTGGACCAGCTGAACAACATCCTGCTGGTTGGCATGACCAACAGGAAGGACATGATCGACGACGCTCTCCTGCGTCCG
GGTCGTCTGGAAGTGCAGATTGAGATCTCGCTGCCAGACGAGGAAGGACGCGTGCAGATGTACGTGCTGTTCCCCTCGTT
CTGTCACCTTTGCTCCGACTGACCTGTCCGCAGTCTCAAGATCCACACGGCCAAGATGTCCAAGAACGGCATCCTCGACC
GCGATGTCGACATTGATAAGCTAGCTTCGAAGACCAAGAACTTTAGCGGTGCCGAGCTGTCTGGTCTGGTGAAGAGCGCC
ACCTCGTTTGCGTTCAGTATGTCCTAGCTTTTTCTCTTCCCTTTTGCGGCATTGACAGCACCCGGCTAACCGTGCAGACC
GACACATCAAGGTGGACACGATGGCGGGCATCAGCGACGATGTGTCGCAGATGAAGGTCAACATGAGCGACTTTGAGAGC
GGCTTGACAGAGGTCAAGGCGGCCTTTGGCGTGTCGGACGAAGAGCTTGAGGAGGCGCTGACATACGGCATCATCCACTA
CTCGCGCACCATTGAGAACATCATCCGGGAGTGCGAGGTGTACGCCGGCAACGTGCGGCAGCTGGACCGACTGCGGCATC
TGTCTGTGCTGTTGGTGGGTGTTTCTTCTCCCCCACTGCCTTTTTTTTTTTTTTTTTTTTTTTTTGGTAATCGTGTCGCT
GACATCTACAGCACGGTCCTGCTGGCAGCGGAAAGACGGCTCTGGCTACACATGTGGCTATCAAGAGCGGATTTCCCTTC
ATCAAGGCTGGTACGTGTTCCATTCTCTTGTCATGATCCGACTTATGCCACGATACTAACAACACAGTCACTCCCGAGAG
CCTGGTGGGCTACTTCAACGAGGCCGGCAAGAAGGACTACCTGCACAAGGTGTTTACGGACGCGTACAAGTCGCCGCTGA
GCCTGTTGATCCTGGACAACATTGAGCGGCTGATTGAGTGGAACCCGGTGGGCCCGCGCATGTCCAACGTGATGGTGCAG
GCGCTGCTGACGCTGCTGCGGGCGCCACCGCCCAAGGGCCACCGGCTTCTGATCCTGGCGACGACATCGCGGCGTTCTGT
GCTCGACCAGCTGGACATGACCGAGGCCTTTGATCGCCAAGTGGCCGTGCCGGCCGTGGCTGACACGACCGAGCTGGCGG
CTGCCCTAACGCAGTTTGGCGCCTTTAGCGACACGGCTGACGTTGGTCAGGCCATCGACACCGTGCGCCAGTACAACGGC
GGTGGCGATCACGTCGGCGTCGGCATCAAGACGGTGCTGACAATGGCCGAGTCGGCGGCCATGGTGGACGACGCAGCCGG
CTGGTTTGCCGATCAGCTGGGCCGGGCGATGGCGGCGAACAATCCGGGAAGTGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62