GenePrediction:GLEAN_685 Details

Name: GLEAN_685
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:1429675..1430559 (+ strand)
Length: 885
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:1429675..1430559 (+ strand)
Length: 885
>GLEAN_685 class=GenePrediction position=GCSC_97:1429675..1430559 (+ strand)
ATGAGCCAGCGGCCGATGCTGCACCAGGCCGATGAGCGGCGGTTCCTGGACGAGCGGGGATCGTCAGCGACAGTGGCACC
CAACGGGCTGAACCCGGCGACGATCATGGAGAAGGCGGTGCGCGAGCGGATCGTGGACAGCTACTTCTGGAAGGAGCAGT
GCTTCGGCGTGAACGAGGCAGACGTGGTCGACCGGGTGGTTGACCACGTCAACTGCATCGGCGGCACGACGGGCACAGCG
CAGAAGCCGACGCCGTTTCTCTGCCTGGCCTTCAAGCTGCTGCAGCTGGCGCCCAACGACGAGATCCTGGCGGCCTACCT
GCAGCACGGCGGCGAGCGATTCAAGTACCTGCGGGCACTGGCACTCTTCTACGTGCGGCTGACGCGCCCCGCCGATGCCG
TCTACCGGACGCTGGAACCATTCCTAGCCGACCGCCGGAAGCTGCGGCGCCGCGGCCGCGCCGGCACGACGCTCACGTTC
GTCGACGACTTTGTCGACGACCTGCTGGTCAAGCCGCGCGTCTGTGCCACCAGCCTGTGGAAGCTGCCGTCGCGCGACGT
GCTCGAGGACCTGGGCAAGCTGGAGCCGCGGGTCAGTCCGCTGGGCGACATTGACGAGATCCTCGACGAGGAGGAGGAAG
AGGCGAGGAGGATGGACGTGGAGGACGAGAACGATGACGCGATGCAAAGGGATCAAGACGACAGGAGCGACGACAGCAGC
CACGATCGCAGGGACAGAAACGGGCGTCGGGCAAGCAGCTATGACAGCGACCGAGATGAGCACGATGACAGGCCTACAGA
ACAGAGGCGGCCAAGACGAGACAGTAGGGATGACGACGATAACTCGTCTGACAGCGGGTCTGGGGCCCGTTCTAGGAGCA
GATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62