GenePrediction:GLEAN_6860 Details

Name: GLEAN_6860
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:1273059..1272126 (- strand)
Length: 934
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:1273059..1272948 (- strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_108:1272544..1272126 (- strand)
Length: 419
>GLEAN_6860 class=GenePrediction position=GCSC_108:1273059..1272126 (- strand)
ATGGCGGGGATTGCAGGCGAGACAGACGACCGCGAGATGCAGAGGCTTGGGATCCGGACGGCCACTCAGTGGACGGCGGA
CAGGCTCCGGGCAGTGCAGAGCGGATTGAGTTGTCGAAGAACAAGGCGGCGAACGAGCGAGGGTGAGACGAAAACACCCC
CCCGTCCTCCACATCAGCCTCCTTCCTTTGTTGCGGTGCGACTGGCTGGTCGAAGTAGGAGGGGCTGGTGGAAAGGAGGG
GCTCTATTTTCCACTCTACATGGTAAGATACCAGTCCGGTAGAGAAAGCGACGGAAACGTACATAGCACAGGGACGGGAT
TTCGATAATTTTCATTGGGCAGACACGAGGCGAGATGAAATGGCTTTCTCGGCTTCTGTTTTGGGGGAATGAAATTCTAC
TACTCCGTACATAGTGTGCAATATCGATTGGCTTTTATCGGGCGGGATTCTTGTTTTTGGCCAGGACACGGCGGAAATAC
AGGTGCATGGTAGCGAAGACTACAGAGGGGCCCAGCGAGAAAGGAGGGGGCGTGTCGGTATTCGGCCAACGACGGCAGCA
GCACTAAGAGAGCGAAGGAAAGAAAAACGGGGAACGCCAACGGCCTCGAACGGGAAAGTCTGGGACCGGTACGGAGTAAG
GCCAAGAGACATACGAGCGAGACGGCCGGAAGAAATGGCACTGTCGACAGGAGCCTGCGCGATGGAGCGGAGCGAAAACG
GATTGGGCGCCGGGGCAGCAGGCCGCTGGGACCGGAGGCCAGCCAATCAGGCCGAGAGGCTGGCGTGATGGGGGGAGCAG
ACCGTGGTGCTGCTGCTGCTGCCGCTGTTGTGCAAGGTGAGATTGGGAGACATGCAGGAGCTGCAGGTGGCGGAAGGAAC
GCCAGGGCATTCAGGCGCACGGAGTCACGGCTAGCTGCGCCCCGAATGGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62